Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G30410 171 / 1e-56 TFCA, KIS TUBULIN FOLDING FACTOR A, tubulin folding cofactor A (KIESEL) (.1), tubulin folding cofactor A (KIESEL) (.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10031896 [exp] 207 / 6e-71 AT2G30410 166 / 7e-55 TUBULIN FOLDING FACTOR A, tubulin folding cofactor A (KIESEL) (.1), tubulin folding cofactor A (KIESEL) (.2)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.013G071100 [exp] 162 / 3e-53 AT2G30410 183 / 2e-61 TUBULIN FOLDING FACTOR A, tubulin folding cofactor A (KIESEL) (.1), tubulin folding cofactor A (KIESEL) (.2)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF02970 [flax] [poplar] TBCA Tubulin binding cofactor A
Representative CDS sequence Show only first row Show all	>Lus10031323 pacid=23150964 polypeptide=Lus10031323 locus=Lus10031323.g ID=Lus10031323.BGIv1.0 annot-version=v1.0 ATGGCTGCAGCAATGAGAAACCTGAAGATCAAGACGAGCACCTGCAAGAGAATCGCCAAGGAGCTACACTCGTACGAGAAAGAGGTCGAGAGAGAGGCTG CGAAGACATCCGACATGAAGGAGAAAGGAGCAGACCCTTACGACCTTAAGCAGCAGGAGAATGTGCTGGCCGAGTCGAGGATGATGATTCCCGATTGCCA CAAGCGCCTCGATGCTTCATTGGCTGACCTGAAATCAACTTTGGCCGAGCTGCTAGAAGAGTCGAAGGAAGGACCTGAGATCGACGATGCTCGAACTGTA ATCAACGAGGTGGAGCAGTTGTAG
AA sequence Show only first row Show all	>Lus10031323 pacid=23150964 polypeptide=Lus10031323 locus=Lus10031323.g ID=Lus10031323.BGIv1.0 annot-version=v1.0 MAAAMRNLKIKTSTCKRIAKELHSYEKEVEREAAKTSDMKEKGADPYDLKQQENVLAESRMMIPDCHKRLDASLADLKSTLAELLEESKEGPEIDDARTV INEVEQL

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G30410		TFCA, KIS	TUBULIN FOLDING FACTOR A, tubu...		Lus10031323 [exp]	0	1
AT3G01390		AVMA10, VMA10	vacuolar membrane ATPase 10 (....		Lus10016977 [exp]	1.7	0.8592
AT1G77350			unknown protein		Lus10018864 [exp]	5.1	0.7821
AT4G23710		VAG2 ,VATG2 ,VH...	vacuolar ATP synthase subunit ...		Lus10021301 [exp]	5.7	0.7767
AT1G07170			PHF5-like protein (.1.2.3)		Lus10018253 [exp]	7.7	0.7761
AT2G37120			S1FA-like DNA-binding protein ...		Lus10015073 [exp]	7.9	0.7462
AT1G50170		ATSIRB	sirohydrochlorin ferrochelatas...		Lus10022245 [exp]	10.4	0.6742
AT1G20540			Transducin/WD40 repeat-like su...		Lus10034576 [exp]	11.4	0.7176
AT2G44620		MTACP1, MTACP-1	mitochondrial acyl carrier pro...		Lus10019500 [exp]	15.2	0.7310
AT2G37120			S1FA-like DNA-binding protein ...		Lus10023177 [exp]	20.8	0.7501
AT1G78790			unknown protein		Lus10042781 [exp]	22.8	0.6819

Compare expression of checked genes

Lus10031323 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.