Gene [FLAX] | FIBexDB

Lus10031362 [FLAX]

External link

Symbol

Arabidopsis homologues

Show only best Show top 10

Locus ID	BLAST score/e-value	TAIR10 short description
AT3G02700	74 / 8e-17	NC domain-containing protein-related (.1)
AT4G00905	69 / 7e-15	NC domain-containing protein-related (.1)
AT1G01225	66 / 5e-14	NC domain-containing protein-related (.1)
AT5G06370	62 / 2e-12	NC domain-containing protein-related (.1)
AT5G16330	52 / 1e-08	NC domain-containing protein-related (.1)
AT5G16360	47 / 4e-07	NC domain-containing protein-related (.1)

Paralogs

Show only best Show top 10

Gene ID	BLAST score/e-value	At best hit	BLAST score/e-value	TAIR10 short description
Lus10010962 [exp]	69 / 4e-15	AT3G02700	268 / 8e-91	NC domain-containing protein-related (.1)
Lus10029402 [exp]	66 / 1e-13	AT5G06370	410 / 3e-146	NC domain-containing protein-related (.1)
Lus10030231 [exp]	61 / 5e-12	AT1G01225	360 / 1e-126	NC domain-containing protein-related (.1)
Lus10005981 [exp]	61 / 5e-12	AT1G01225	360 / 8e-127	NC domain-containing protein-related (.1)
Lus10004198 [exp]	54 / 2e-09	AT5G06370	210 / 1e-68	NC domain-containing protein-related (.1)

Poplar homologues

Show only best Show top 10

Locus ID	BLAST score/e-value	At best hit	BLAST score/e-value	TAIR10 short description
Potri.004G078700 [exp]	78 / 2e-18	AT3G02700	343 / 3e-120	NC domain-containing protein-related (.1)
Potri.017G142300 [exp]	76 / 1e-17	AT3G02700	328 / 2e-114	NC domain-containing protein-related (.1)
Potri.006G203300 [exp]	63 / 6e-13	AT5G06370	396 / 4e-141	NC domain-containing protein-related (.1)
Potri.014G101300 [exp]	62 / 2e-12	AT1G01225	352 / 2e-123	NC domain-containing protein-related (.1)
Potri.002G174700 [exp]	62 / 2e-12	AT1G01225	333 / 7e-116	NC domain-containing protein-related (.1)

PFAM info

Representative CDS sequence

Show only first row Show all

>Lus10031362 pacid=23155969 polypeptide=Lus10031362 locus=Lus10031362.g ID=Lus10031362.BGIv1.0 annot-version=v1.0

ATGGTGGAACGTGCACTCGCGCTCCTTCTGACCCTCCCGAAGAAGTCCTCCGCCGAGCTTTCACCCTCCTCGACACTAATGGCTATGGACGCTAAAAACC

TCTCAAGAAACAACTGCGAGGATTTCGCGGTCTACTGCAAGACCGAACTGCGAATTATTAGGGGCAGGAGCGGACAGGTGGAATCTCTGTACGCTGCTAC

ATCATCTGTGGGGTCGTGTTCTTTGACTTCGAGTGCAAACTTGGGGGTCGTGGCGGCAGTTGGGTTCAGCAAGTATTGCTACCACCGTTACAATGCTGAC

ATTGGGGCGCGGAGCGATGTTGCTAAGGTTCCAGTCGAGATGCTGGTCGCCGAGCTAGATGAACATGAATGA

AA sequence

Show only first row Show all

>Lus10031362 pacid=23155969 polypeptide=Lus10031362 locus=Lus10031362.g ID=Lus10031362.BGIv1.0 annot-version=v1.0

MVERALALLLTLPKKSSAELSPSSTLMAMDAKNLSRNNCEDFAVYCKTELRIIRGRSGQVESLYAATSSVGSCSLTSSANLGVVAAVGFSKYCYHRYNAD

IGARSDVAKVPVEMLVAELDEHE

DESeq2's median of ratios [FLAX]

Coexpressed genes

Download tab-delimited text

Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G02700			NC domain-containing protein-r...		Lus10031362 [exp]	0	1

Lus10031362 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.