Lus10031368 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT3G03250 49 / 5e-08 AtUGP1, UGP1, UGP UDP-GLUCOSE PYROPHOSPHORYLASE 1 (.1)
AT5G17310 47 / 2e-07 AtUGP2, UGP2 UDP-glucose pyrophosphorylase 2 (.1.2)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10010957 74 / 9e-17 AT3G03250 676 / 0.0 UDP-GLUCOSE PYROPHOSPHORYLASE 1 (.1)
Lus10031365 72 / 2e-16 AT3G03250 662 / 0.0 UDP-GLUCOSE PYROPHOSPHORYLASE 1 (.1)
Lus10007370 66 / 5e-14 AT5G17310 785 / 0.0 UDP-glucose pyrophosphorylase 2 (.1.2)
Lus10020788 66 / 6e-14 AT5G17310 781 / 0.0 UDP-glucose pyrophosphorylase 2 (.1.2)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.004G074400 54 / 1e-09 AT5G17310 759 / 0.0 UDP-glucose pyrophosphorylase 2 (.1.2)
Potri.017G144700 50 / 1e-08 AT5G17310 782 / 0.0 UDP-glucose pyrophosphorylase 2 (.1.2)
PFAM info
Representative CDS sequence
>Lus10031368 pacid=23155816 polypeptide=Lus10031368 locus=Lus10031368.g ID=Lus10031368.BGIv1.0 annot-version=v1.0
ATGGCTGTCGCTACCGAGAGACTGTCCGCCTTGGAACCTGCCGTAGCCGCTCTCGATCAGATCAGTGAGAGCGAGAAGAATGGCTTCATCAGCCTCGTCT
CCCGCTATCTCAGGCAAGATCGGAGCCTTTGCTGTGTGTTTTGGATGTTCATTTCTATGCTTTTGTTGATTCCTGAGAAGGACTGCGTAAATCGTAATGC
GTTGATCTTATCTACGTCTGGATTTGTTGCTGCACGGAATAGACGTCCTCGTCCGGCGGCTTGA
AA sequence
>Lus10031368 pacid=23155816 polypeptide=Lus10031368 locus=Lus10031368.g ID=Lus10031368.BGIv1.0 annot-version=v1.0
MAVATERLSALEPAVAALDQISESEKNGFISLVSRYLRQDRSLCCVFWMFISMLLLIPEKDCVNRNALILSTSGFVAARNRRPRPAA

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT3G03250 AtUGP1, UGP1, U... UDP-GLUCOSE PYROPHOSPHORYLASE ... Lus10031368 0 1
AT3G20050 ATTCP-1 T-complex protein 1 alpha subu... Lus10036713 1.0 0.8229
AT4G30700 Pentatricopeptide repeat (PPR)... Lus10036596 9.1 0.7803
AT4G32840 PFK6 phosphofructokinase 6 (.1) Lus10005488 10.4 0.7136
AT5G42200 RING/U-box superfamily protein... Lus10017253 12.6 0.7043
AT4G10620 P-loop containing nucleoside t... Lus10035986 15.0 0.7075
AT4G21440 MYB ATMYB102, ATM4 A. THALIANA MYB 4, MYB-like 10... Lus10033737 23.0 0.6846
AT3G12340 FKBP-like peptidyl-prolyl cis-... Lus10011649 26.2 0.6344
AT5G11630 unknown protein Lus10011623 26.8 0.6312
AT5G64860 DPE1 disproportionating enzyme (.1) Lus10036628 33.9 0.7041
AT5G16080 ATCXE17 carboxyesterase 17 (.1) Lus10017587 34.0 0.6577

Lus10031368 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.