Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G19615 40 / 3e-05 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10042265 [exp] 59 / 4e-12 AT3G19615 60 / 1e-12 unknown protein
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G294800 [exp] 42 / 6e-06 AT3G19615 44 / 6e-07 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10031599 pacid=23156046 polypeptide=Lus10031599 locus=Lus10031599.g ID=Lus10031599.BGIv1.0 annot-version=v1.0 ATGGAGGGTTTAATCCCGCTTCTGATCCGCGCAGTTAAGAAGCAGAGCATCATCAGCAAGCCCGCATTCCACCACCTCCGCAACTTGGAGTCCTTTTCCG AAAGCTCTACTCGAAGTCGAAGCTACCATCCGCTGATCGGAGAACCCTTGAATGATGGATCGTCTCACCGGCGGACCCAGTCGGAGAACCAGCCTCCCAC TGCCGATTTCTTGGAGCAGAGGTCACCTGTGATCTGCTTCGCTCCTGCTGTGGCCTCAGGAATTCGCCAGAGAAAGTCCTCCAGTAACCCTGATGCGGTT AGAGTACAAATTCCCGGTTCGACTCAATGCTCGGTTCGGTTCTGA
AA sequence Show only first row Show all	>Lus10031599 pacid=23156046 polypeptide=Lus10031599 locus=Lus10031599.g ID=Lus10031599.BGIv1.0 annot-version=v1.0 MEGLIPLLIRAVKKQSIISKPAFHHLRNLESFSESSTRSRSYHPLIGEPLNDGSSHRRTQSENQPPTADFLEQRSPVICFAPAVASGIRQRKSSSNPDAV RVQIPGSTQCSVRF

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G19615			unknown protein		Lus10031599 [exp]	0	1
AT1G79460		ATKS1, ATKS, GA...	GA REQUIRING 2, ARABIDOPSIS TH...		Lus10014673 [exp]	1.4	0.9846
AT1G09090		ATRBOHB-BETA, A...	respiratory burst oxidase homo...		Lus10020644 [exp]	5.3	0.9844
AT1G14540			Peroxidase superfamily protein...		Lus10009904 [exp]	6.0	0.9812
AT5G39150			RmlC-like cupins superfamily p...		Lus10006536 [exp]	6.0	0.9818
AT2G47710			Adenine nucleotide alpha hydro...		Lus10006701 [exp]	7.3	0.9797
AT2G30490		REF3, CYP73A5, ...	REDUCED EPRDERMAL FLUORESCENCE...		Lus10027598 [exp]	7.7	0.9803
					Lus10022008 [exp]	8.5	0.9719
AT1G72280		AERO1	endoplasmic reticulum oxidored...		Lus10038515 [exp]	11.7	0.9720
AT1G72360	AP2_ERF	AtERF73, HRE1	HYPOXIA RESPONSIVE ERF \(ETHYL...		Lus10003601 [exp]	11.8	0.9778
					Lus10019232 [exp]	13.0	0.9727

Compare expression of checked genes

Lus10031599 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.