Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G52790 96 / 8e-27 peptidoglycan-binding LysM domain-containing protein (.1) AT5G62150 94 / 4e-26 peptidoglycan-binding LysM domain-containing protein (.1) AT4G25433 93 / 1e-25 peptidoglycan-binding LysM domain-containing protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10027407 [exp] 158 / 4e-51 AT3G52790 115 / 2e-34 peptidoglycan-binding LysM domain-containing protein (.1) Lus10015011 [exp] 103 / 1e-29 AT5G62150 107 / 5e-32 peptidoglycan-binding LysM domain-containing protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.014G077900 [exp] 126 / 1e-38 AT4G25433 108 / 7e-32 peptidoglycan-binding LysM domain-containing protein (.1) Potri.015G137500 [exp] 118 / 1e-35 AT4G25433 113 / 7e-34 peptidoglycan-binding LysM domain-containing protein (.1) Potri.010G231000 [exp] 112 / 4e-33 AT3G52790 119 / 3e-36 peptidoglycan-binding LysM domain-containing protein (.1) Potri.002G152600 [exp] 111 / 1e-32 AT5G62150 100 / 1e-28 peptidoglycan-binding LysM domain-containing protein (.1) Potri.012G135100 [exp] 109 / 5e-32 AT4G25433 108 / 5e-32 peptidoglycan-binding LysM domain-containing protein (.1) Potri.008G030200 [exp] 108 / 6e-32 AT3G52790 114 / 1e-34 peptidoglycan-binding LysM domain-containing protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0187 [flax] [poplar] LysM PF01476 [flax] [poplar] LysM LysM domain
Representative CDS sequence Show only first row Show all	>Lus10031662 pacid=23180679 polypeptide=Lus10031662 locus=Lus10031662.g ID=Lus10031662.BGIv1.0 annot-version=v1.0 ATGAACTCCCCGACCACCGGCCGCCGGACAAGATCCAGCGACAGCACCAACAACAGCTTAGTAGTAGCTGACGCAGCGTCGTGGTACTGCGCCACCATCC TGCTCGGGCTCATCCTGATGGCCTCCATCATGGAGAGCTCGTCGGAGTCGGACGACTCCTTGGCGGCGACGGTGAAGGGGAATCAGCTCCTCGGCGACCG GCCGTGCGACGAGATATACGTGGTGAGAGAAGGGGAGACGCTGAACACCATAAGCGAGAAGTGCGGCGACCCGTACATCGTGGAGGAGAACCCGCATATC CACGACCCGGATGACGTGTTTCCGGGCCTCGTCATCAAAATCACCCCTTCTTCTTCTTCTTCTTCCGGCGGCAATATGAGAAATTGA
AA sequence Show only first row Show all	>Lus10031662 pacid=23180679 polypeptide=Lus10031662 locus=Lus10031662.g ID=Lus10031662.BGIv1.0 annot-version=v1.0 MNSPTTGRRTRSSDSTNNSLVVADAASWYCATILLGLILMASIMESSSESDDSLAATVKGNQLLGDRPCDEIYVVREGETLNTISEKCGDPYIVEENPHI HDPDDVFPGLVIKITPSSSSSSGGNMRN

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G52790			peptidoglycan-binding LysM dom...		Lus10031662 [exp]	0	1
AT5G48930		HCT	hydroxycinnamoyl-CoA shikimate...		Lus10002321 [exp]	1.7	0.9720
AT1G52760		LysoPL2	lysophospholipase 2 (.1)		Lus10025754 [exp]	2.4	0.9675
AT1G72220			RING/U-box superfamily protein...		Lus10015901 [exp]	3.5	0.9647
AT1G52760		LysoPL2	lysophospholipase 2 (.1)		Lus10035909 [exp]	6.3	0.9627
AT3G19450		CAD-C, ATCAD4	CINNAMYL ALCOHOL DEHYDROGENASE...		Lus10014104 [exp]	11.5	0.9495
AT4G01070		UGT72B1, GT72B1	UDP-GLUCOSE-DEPENDENT GLUCOSYL...		Lus10029452 [exp]	11.5	0.9337
AT5G48930		HCT	hydroxycinnamoyl-CoA shikimate...		Lus10026097 [exp]	12.0	0.9484
AT2G03200			Eukaryotic aspartyl protease f...		Lus10035961 [exp]	12.2	0.9564
AT2G37040		PAL1, ATPAL1	PHE ammonia lyase 1 (.1)		Lus10040416 [exp]	13.0	0.9464
AT5G54160		ATOMT1	O-methyltransferase 1 (.1)		Lus10032929 [exp]	13.6	0.9568

Compare expression of checked genes

Lus10031662 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.