Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G51720 116 / 4e-35 2 iron, 2 sulfur cluster binding (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10031105 [exp] 169 / 6e-56 AT5G51720 125 / 7e-39 2 iron, 2 sulfur cluster binding (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.015G132500 [exp] 129 / 6e-40 AT5G51720 131 / 5e-41 2 iron, 2 sulfur cluster binding (.1) Potri.012G130600 [exp] 128 / 8e-40 AT5G51720 130 / 1e-40 2 iron, 2 sulfur cluster binding (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF09360 [flax] [poplar] zf-CDGSH Iron-binding zinc finger CDGSH type
Representative CDS sequence Show only first row Show all	>Lus10031686 pacid=23180567 polypeptide=Lus10031686 locus=Lus10031686.g ID=Lus10031686.BGIv1.0 annot-version=v1.0 ATGGCTTCAATTTCCACTGCTAGCTTCTTCTGCCCCGCCAACCCGTCGAGAACCGACGGCATCAACCATTCCTCTGCCGCCACTGCCGTCGCAGTGCCAG TGCGCCGCCGGCGAGTCGTCTCAGTAAGAGCAGAGGCACAGGCGATTAACCCGGAGATCAGGAAGAGCGAGGACAAGGTAGTGGATTCCGTCGAGGTCAC GACTCTTTCCAAACCCCTAACAGCCTATTGCAGGTGTTGGAGGTCGCAGACGTTCCCGCTTTGTGACGGGAGCCATGTGAAGCATAACAAGGCAACGGGA GACAACGTCGGGCCTCTGCTATTGAAGAAGCCTAAAGAGTAG
AA sequence Show only first row Show all	>Lus10031686 pacid=23180567 polypeptide=Lus10031686 locus=Lus10031686.g ID=Lus10031686.BGIv1.0 annot-version=v1.0 MASISTASFFCPANPSRTDGINHSSAATAVAVPVRRRRVVSVRAEAQAINPEIRKSEDKVVDSVEVTTLSKPLTAYCRCWRSQTFPLCDGSHVKHNKATG DNVGPLLLKKPKE

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G51720			2 iron, 2 sulfur cluster bindi...		Lus10031686 [exp]	0	1
AT5G51720			2 iron, 2 sulfur cluster bindi...		Lus10031105 [exp]	1.0	0.9792
AT4G16490			ARM repeat superfamily protein...		Lus10017562 [exp]	2.0	0.9481
AT3G01060			unknown protein		Lus10005219 [exp]	2.4	0.9318
AT3G21890	CO		B-box type zinc finger family ...		Lus10031583 [exp]	4.0	0.9243
AT3G01060			unknown protein		Lus10030700 [exp]	4.5	0.9052
AT5G64290		DCT, DIT2.1	dicarboxylate transport 2.1 (....		Lus10023778 [exp]	5.0	0.8808
AT4G16490			ARM repeat superfamily protein...		Lus10017563 [exp]	5.5	0.9236
AT5G24460			unknown protein		Lus10015572 [exp]	5.7	0.9082
AT3G18490			Eukaryotic aspartyl protease f...		Lus10032481 [exp]	7.5	0.9205
AT2G05620		PGR5	proton gradient regulation 5 (...		Lus10011777 [exp]	8.5	0.9234

Compare expression of checked genes

Lus10031686 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.