Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G30410 147 / 2e-47 TFCA, KIS TUBULIN FOLDING FACTOR A, tubulin folding cofactor A (KIESEL) (.1), tubulin folding cofactor A (KIESEL) (.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10031323 [exp] 182 / 6e-61 AT2G30410 171 / 1e-56 TUBULIN FOLDING FACTOR A, tubulin folding cofactor A (KIESEL) (.1), tubulin folding cofactor A (KIESEL) (.2)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.013G071100 [exp] 145 / 3e-46 AT2G30410 183 / 2e-61 TUBULIN FOLDING FACTOR A, tubulin folding cofactor A (KIESEL) (.1), tubulin folding cofactor A (KIESEL) (.2)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF02970 [flax] [poplar] TBCA Tubulin binding cofactor A
Representative CDS sequence Show only first row Show all	>Lus10031896 pacid=23180707 polypeptide=Lus10031896 locus=Lus10031896.g ID=Lus10031896.BGIv1.0 annot-version=v1.0 ATGGCTGCGGCAATGAGAAACCTGAAGATCAAGACGAGCACCTGCAAGCGAATCGCCAAGGAGCTACACTCGTACAAGAAAGAGGTTGAGAGAGAGGCTG CTAAGACATCCAACATGAAGGAGAAAGGAGCGGACCCTTACGACCTCAAGCAGCAGGAGAATGTGCTGGCCGAGTCGAGGATGATGATCCCCGATTGCCA CAAGCGCCTCGATGCTGCATTGGCTGACCTGAATTCAACTCTGGCCGAGCTGCTGGAAGAGTCGACGGAAGGACCCGAGATTGATGATGCTCGAACTGTA ATCAACGAGGTGGAGCAGTTGTATCAGAAAGGAGATGATGTTTAG
AA sequence Show only first row Show all	>Lus10031896 pacid=23180707 polypeptide=Lus10031896 locus=Lus10031896.g ID=Lus10031896.BGIv1.0 annot-version=v1.0 MAAAMRNLKIKTSTCKRIAKELHSYKKEVEREAAKTSNMKEKGADPYDLKQQENVLAESRMMIPDCHKRLDAALADLNSTLAELLEESTEGPEIDDARTV INEVEQLYQKGDDV

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G30410		TFCA, KIS	TUBULIN FOLDING FACTOR A, tubu...		Lus10031896 [exp]	0	1
AT4G02980		ABP1	endoplasmic reticulum auxin bi...		Lus10029633 [exp]	1.0	0.9000
AT3G17210		ATHS1	A. THALIANA HEAT STABLE PROTEI...		Lus10037823 [exp]	5.7	0.8474
AT2G27020		PAG1	20S proteasome alpha subunit G...		Lus10037416 [exp]	7.6	0.8795
AT1G52600			Peptidase S24/S26A/S26B/S26C f...		Lus10023131 [exp]	7.7	0.8469
AT2G34520		RPS14	mitochondrial ribosomal protei...		Lus10034657 [exp]	9.8	0.8541
AT5G13710		CPH, SMT1	CEPHALOPOD, sterol methyltrans...		Lus10039600 [exp]	10.1	0.8113
AT1G76860			Small nuclear ribonucleoprotei...		Lus10011293 [exp]	10.2	0.8387
AT3G22630		PRCGB, PBD1	20S proteasome beta subunit D1...		Lus10039351 [exp]	13.6	0.7901
AT1G09630		ATRAB-A2A, ATRA...	ARABIDOPSIS RAB GTPASE A2A, RA...		Lus10041116 [exp]	18.6	0.8141
AT3G05070			unknown protein		Lus10026367 [exp]	19.7	0.8328

Compare expression of checked genes

Lus10031896 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.