Plant FIBer expression Database

Lus10031936 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT1G68260 49 / 4e-08 Thioesterase superfamily protein (.1)
AT1G68280 46 / 4e-07 Thioesterase superfamily protein (.1)
AT1G35290 44 / 2e-06 Thioesterase superfamily protein (.1)
AT1G35250 40 / 4e-05 Thioesterase superfamily protein (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10035143
[exp]
102 / 4e-28 AT1G68260 239 / 8e-81 Thioesterase superfamily protein (.1)
Lus10031959
[exp]
55 / 1e-10 AT1G68260 221 / 5e-75 Thioesterase superfamily protein (.1)
Lus10035152
[exp]
50 / 2e-08 AT1G68260 200 / 3e-65 Thioesterase superfamily protein (.1)
Lus10031948
[exp]
48 / 1e-07 AT1G68260 201 / 8e-66 Thioesterase superfamily protein (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.010G123102
[exp]
52 / 2e-09 AT1G68260 237 / 6e-80 Thioesterase superfamily protein (.1)
PFAM info
Representative CDS sequence
>Lus10031936 pacid=23161141 polypeptide=Lus10031936 locus=Lus10031936.g ID=Lus10031936.BGIv1.0 annot-version=v1.0
ATGTTGCCGCGGGGAGGATTGATTTCCAATTCTACCGCGAAACTACAACCGCCGACGCTCCGCGCCTGCACGAAATCCTGGCCTTTGCGCCGCCTTCCGC
CGCCGTCCTCCACTACACTCCGCCGACAGCTCCATCCGCCGTCGCATCTGCAATTGCGACCTTCCAGGAGCCGACGAAGCACTGCCACCTCCTCACTTTT
TGATATCAAAGGTGGAATGCAACACGGTCGTCATGAACTGCTGGAGAGCATTGGTCTGAGTGCAGATGATGTTGCTCGTACAGGTGACGAGTTGGCTCTT
TCTGAGTAA
AA sequence
>Lus10031936 pacid=23161141 polypeptide=Lus10031936 locus=Lus10031936.g ID=Lus10031936.BGIv1.0 annot-version=v1.0
MLPRGGLISNSTAKLQPPTLRACTKSWPLRRLPPPSSTTLRRQLHPPSHLQLRPSRSRRSTATSSLFDIKGGMQHGRHELLESIGLSADDVARTGDELAL
SE

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT1G68260 Thioesterase superfamily prote... Lus10031936
[exp]
0 1
AT2G34930 disease resistance family prot... Lus10002758
[exp]
3.2 0.7304
AT5G20690 Leucine-rich repeat protein ki... Lus10005175
[exp]
3.2 0.7105
AT2G34930 disease resistance family prot... Lus10002757
[exp]
6.0 0.6683
AT3G07610 IBM1 increase in bonsai methylation... Lus10004602
[exp]
13.3 0.5785
Lus10008923
[exp]
16.6 0.5975
Lus10027418
[exp]
29.8 0.5764
AT2G26530 AR781 Protein of unknown function (D... Lus10032766
[exp]
31.4 0.6172
AT3G47340 AT-ASN1, DIN6, ... DARK INDUCIBLE 6, ARABIDOPSIS ... Lus10031870
[exp]
31.9 0.5448
AT4G05220 Late embryogenesis abundant (L... Lus10020065
[exp]
42.0 0.5550
AT5G16080 ATCXE17 carboxyesterase 17 (.1) Lus10017587
[exp]
42.4 0.5757

Lus10031936 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.