Lus10032230 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT1G62770 134 / 2e-39 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
AT5G62350 125 / 5e-36 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
AT3G47380 120 / 4e-34 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
AT4G25260 119 / 2e-33 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
AT4G12390 117 / 7e-33 PME1 pectin methylesterase inhibitor 1 (.1)
AT5G62360 102 / 4e-27 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
AT1G14890 98 / 2e-25 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
AT1G70720 95 / 4e-24 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
AT1G62760 95 / 3e-23 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
AT2G01610 91 / 1e-22 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10024593 270 / 1e-92 AT1G62770 162 / 2e-50 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Lus10038914 138 / 4e-41 AT5G62350 192 / 1e-62 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Lus10027198 137 / 2e-40 AT5G62350 191 / 3e-62 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Lus10031133 122 / 2e-34 AT5G62350 211 / 8e-70 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Lus10031713 115 / 3e-32 AT5G62350 202 / 4e-66 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Lus10031711 110 / 5e-30 AT5G62360 145 / 4e-44 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Lus10031132 103 / 2e-27 AT1G62760 135 / 3e-40 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Lus10031138 91 / 2e-22 AT5G62360 172 / 3e-54 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Lus10030292 86 / 1e-20 AT4G00080 158 / 1e-48 unfertilized embryo sac 11, Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.012G127500 137 / 1e-40 AT5G62350 220 / 2e-73 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Potri.015G128700 136 / 3e-40 AT5G62350 221 / 7e-74 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Potri.003G113700 130 / 6e-38 AT4G12390 178 / 1e-56 pectin methylesterase inhibitor 1 (.1)
Potri.001G119200 104 / 4e-29 AT1G62770 117 / 2e-34 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Potri.015G128300 103 / 2e-27 AT5G62360 192 / 1e-62 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Potri.015G128900 102 / 3e-27 AT4G25250 145 / 4e-44 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Potri.010G109300 100 / 2e-26 AT1G14890 218 / 5e-72 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Potri.008G132600 100 / 4e-26 AT1G14890 216 / 1e-71 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Potri.015G128100 98 / 2e-25 AT5G62360 221 / 1e-73 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Potri.002G145800 97 / 4e-25 AT4G00080 164 / 4e-51 unfertilized embryo sac 11, Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
PF04043 PMEI Plant invertase/pectin methylesterase inhibitor
Representative CDS sequence
>Lus10032230 pacid=23168466 polypeptide=Lus10032230 locus=Lus10032230.g ID=Lus10032230.BGIv1.0 annot-version=v1.0
ATGGCAAACCATCTTCTTCTTTTCCTTCCATTCATCCTCCTACCCCTCTCATTTCCCCACTTCACAACCTCAGCCATCAACCCACAACAACAACAACAAC
CATCACCCTTCATATCATCGTCATGCAAGCTCACCCTCTACCCAGACCTCTGCATCCAGTCCCTCTCCCCTTACTCAACCTCCATCCGCCAAAACGACCA
CCGCCGCCTCGCCCTCGCCGCCCTCTCCTTCAGCCTCTCCCGCGCCAGGTCAGCCTCCGCCTACATCTCCACCGTCCGCCGCCCCATTACTCCGAGTTTG
AACCAGGCGGTCGATGACTGCATCCGCAACATGGCCGACGGTGTCGCCCGGCTGACCCAGTCGGTCAGCGAGCTGGGCCAGATGGGCTCGGGCGGGCCCG
AGGATCGGTTCCAGTGGCACATGAGTAACTTGCAGACGTGGGTGAGTACCGCGCTGACCTGCGAGAACAGCTGCGTTGACGGGTTTAACGCGAGGGAGCT
GGATGGTCCGGTTAAGGATGCGGTTCGGAACCGGGTTGTTTATGTGGCTAAGGTTACTAGTAATGCTCTTGCCTTGATTCATGGGTTTGCTTCTAAGCAT
AACCGCCCTGGGAGGCTTCCTTGA
AA sequence
>Lus10032230 pacid=23168466 polypeptide=Lus10032230 locus=Lus10032230.g ID=Lus10032230.BGIv1.0 annot-version=v1.0
MANHLLLFLPFILLPLSFPHFTTSAINPQQQQQPSPFISSSCKLTLYPDLCIQSLSPYSTSIRQNDHRRLALAALSFSLSRARSASAYISTVRRPITPSL
NQAVDDCIRNMADGVARLTQSVSELGQMGSGGPEDRFQWHMSNLQTWVSTALTCENSCVDGFNARELDGPVKDAVRNRVVYVAKVTSNALALIHGFASKH
NRPGRLP

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT1G62770 Plant invertase/pectin methyle... Lus10032230 0 1
AT5G13870 EXGT-A4, XTH5, ... endoxyloglucan transferase A4,... Lus10003022 1.4 0.9786
AT5G13870 EXGT-A4, XTH5, ... endoxyloglucan transferase A4,... Lus10011052 1.7 0.9827
AT4G35200 Arabidopsis protein of unknown... Lus10003332 4.0 0.9577
AT1G62770 Plant invertase/pectin methyle... Lus10024593 4.2 0.9446
AT4G35200 Arabidopsis protein of unknown... Lus10022635 5.7 0.9536
AT1G06930 unknown protein Lus10024185 6.0 0.9673
AT5G24070 Peroxidase superfamily protein... Lus10025586 6.3 0.9566
AT5G60520 Late embryogenesis abundant (L... Lus10036107 6.9 0.9648
AT5G57090 MM31, ATPIN2, A... WAVY ROOTS 6, ETHYLENE INSENSI... Lus10001429 8.3 0.9690
AT2G44380 Cysteine/Histidine-rich C1 dom... Lus10003919 10.6 0.9600

Lus10032230 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.