Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G62600 117 / 2e-32 Flavin-binding monooxygenase family protein (.1) AT1G63370 114 / 2e-31 Flavin-binding monooxygenase family protein (.1) AT1G62620 113 / 4e-31 Flavin-binding monooxygenase family protein (.1) AT1G12200 97 / 7e-25 FMO flavin monooxygenase, Flavin-binding monooxygenase family protein (.1) AT1G62540 95 / 2e-24 FMOGS-OX2 ,FMO GS-OX2 flavin-monooxygenase glucosinolate S-oxygenase 2 (.1) AT1G62580 89 / 3e-22 NOGC1 nitric oxide-dependent guanylate cyclase 1, Flavin-binding monooxygenase family protein (.1) AT1G12160 86 / 4e-21 Flavin-binding monooxygenase family protein (.1) AT1G62570 86 / 5e-21 FMOGS-OX4 ,FMO GS-OX4 flavin-monooxygenase glucosinolate S-oxygenase 4 (.1) AT1G12130 86 / 8e-21 Flavin-binding monooxygenase family protein (.1) AT1G62560 83 / 4e-20 FMOGS-OX3 ,FMO GS-OX3 flavin-monooxygenase glucosinolate S-oxygenase 3 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10024598 [exp] 191 / 9e-61 AT1G62620 587 / 0.0 Flavin-binding monooxygenase family protein (.1) Lus10024609 [exp] 113 / 3e-31 AT1G62560 444 / 1e-154 flavin-monooxygenase glucosinolate S-oxygenase 3 (.1) Lus10032247 [exp] 75 / 2e-17 AT1G12140 315 / 1e-105 flavin-monooxygenase glucosinolate S-oxygenase 5 (.1.2) Lus10015731 [exp] 69 / 7e-15 AT5G07800 621 / 0.0 Flavin-binding monooxygenase family protein (.1) Lus10003474 [exp] 66 / 6e-14 AT5G07800 623 / 0.0 Flavin-binding monooxygenase family protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G121100 [exp] 125 / 1e-35 AT1G62600 607 / 0.0 Flavin-binding monooxygenase family protein (.1) Potri.001G121000 [exp] 101 / 1e-26 AT1G12200 557 / 0.0 flavin monooxygenase, Flavin-binding monooxygenase family protein (.1) Potri.013G019900 [exp] 98 / 3e-25 AT1G62600 513 / 0.0 Flavin-binding monooxygenase family protein (.1) Potri.012G067500 [exp] 77 / 9e-18 AT5G07800 696 / 0.0 Flavin-binding monooxygenase family protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10032235 pacid=23168667 polypeptide=Lus10032235 locus=Lus10032235.g ID=Lus10032235.BGIv1.0 annot-version=v1.0 ATGCTGCCTTCGCAGGAAGAAATGATGGAAGATGTCAAAGCATTCTATTCAAAACTCGAATCTTCGAACATCCCTAAACGATACACTCATAACTTGGATC TTGACCAGTTTGAATACAATGACTGGATTTCTGCTCAATGTGGGTGCCCTGACTTTGAGGAATGGAGAAAGGGAATGTACCTCTCGTCAAGGGAAGACAA GCGGCACACCCCAGAGGGCTATCGCGAAGAATGGAACGATCACGAGTTGATAGCAGAAGCCAACAGGGACTTTGCAAAATACTCGTTAAAGTGA
AA sequence Show only first row Show all	>Lus10032235 pacid=23168667 polypeptide=Lus10032235 locus=Lus10032235.g ID=Lus10032235.BGIv1.0 annot-version=v1.0 MLPSQEEMMEDVKAFYSKLESSNIPKRYTHNLDLDQFEYNDWISAQCGCPDFEEWRKGMYLSSREDKRHTPEGYREEWNDHELIAEANRDFAKYSLK

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G62600			Flavin-binding monooxygenase f...		Lus10032235 [exp]	0	1

Compare expression of checked genes

Lus10032235 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.