Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G02160 103 / 3e-31 Cox19 family protein (CHCH motif) (.1), Cox19 family protein (CHCH motif) (.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10024637 [exp] 147 / 3e-48 AT1G02160 105 / 6e-32 Cox19 family protein (CHCH motif) (.1), Cox19 family protein (CHCH motif) (.2)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.014G051850 [exp] 118 / 6e-37 AT1G02160 107 / 2e-32 Cox19 family protein (CHCH motif) (.1), Cox19 family protein (CHCH motif) (.2)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10032273 pacid=23168666 polypeptide=Lus10032273 locus=Lus10032273.g ID=Lus10032273.BGIv1.0 annot-version=v1.0 ATGATGGAATCTAAAACACCGGCCGCCGGAGAAGCAACTCCTTACCAGAGTGCAGCGAGGATATCCGATTCCCAATGCTTCCCTCAATACTCCGCCTCTC TCAAGTGTCTGGAGCAGTTCAGCACAGACAAGAGCAAGTGTCAGCAGCATTTTGACATCTATAAAGAATGCAAGAAAAAAGAGAGGGAAGCTAGGCTAGA ACGCAACAAGACCCGCTCACTCTTTTCTTGA
AA sequence Show only first row Show all	>Lus10032273 pacid=23168666 polypeptide=Lus10032273 locus=Lus10032273.g ID=Lus10032273.BGIv1.0 annot-version=v1.0 MMESKTPAAGEATPYQSAARISDSQCFPQYSASLKCLEQFSTDKSKCQQHFDIYKECKKKEREARLERNKTRSLFS

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G02160			Cox19 family protein (CHCH mot...		Lus10032273 [exp]	0	1
AT2G22870		EMB2001	embryo defective 2001, P-loop ...		Lus10011703 [exp]	1.0	0.8210
AT5G59750			DHBP synthase RibB-like alpha/...		Lus10040865 [exp]	9.2	0.7590
AT1G31812		ACBP6, ACBP	acyl-CoA-binding protein 6 (.1...		Lus10021246 [exp]	9.8	0.7587
AT5G09920		NRPB4, ATRPB15....	RNA polymerase II, Rpb4, core ...		Lus10005796 [exp]	14.8	0.7524
AT1G29510		SAUR68	SMALL AUXIN UPREGULATED 68, SA...		Lus10020439 [exp]	15.1	0.8082
AT5G60335			Thioesterase superfamily prote...		Lus10028483 [exp]	18.6	0.7605
					Lus10029656 [exp]	20.9	0.7764
AT2G35450			catalytics;hydrolases (.1)		Lus10037047 [exp]	24.9	0.7778
AT1G47278			unknown protein		Lus10040837 [exp]	27.2	0.6922
AT1G05430			unknown protein		Lus10006108 [exp]	27.3	0.7197

Compare expression of checked genes

Lus10032273 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.