Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G65660 84 / 4e-22 hydroxyproline-rich glycoprotein family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10028220 [exp] 119 / 4e-36 AT5G65660 100 / 3e-28 hydroxyproline-rich glycoprotein family protein (.1) Lus10042928 [exp] 104 / 2e-30 AT5G65660 66 / 8e-15 hydroxyproline-rich glycoprotein family protein (.1) Lus10042927 [exp] 104 / 3e-30 AT5G65660 95 / 6e-26 hydroxyproline-rich glycoprotein family protein (.1) Lus10028221 [exp] 102 / 3e-29 AT5G65660 66 / 1e-14 hydroxyproline-rich glycoprotein family protein (.1) Lus10039633 [exp] 82 / 2e-21 AT5G65660 147 / 1e-46 hydroxyproline-rich glycoprotein family protein (.1) Lus10002158 [exp] 78 / 2e-19 AT5G65660 146 / 3e-46 hydroxyproline-rich glycoprotein family protein (.1) Lus10019240 [exp] 66 / 1e-13 AT5G10560 407 / 1e-133 Glycosyl hydrolase family protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.002G108100 [exp] 100 / 8e-29 AT5G65660 95 / 6e-26 hydroxyproline-rich glycoprotein family protein (.1) Potri.019G055500 [exp] 64 / 2e-14 AT5G65660 114 / 2e-33 hydroxyproline-rich glycoprotein family protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10032818 pacid=23164801 polypeptide=Lus10032818 locus=Lus10032818.g ID=Lus10032818.BGIv1.0 annot-version=v1.0 ATGGAGGAGGATGATCGTACGGTGATTGGTGTCCCTGTGGGTTTGGCTCTTCTCCTAGTTAGCCTGTTTACAATGACAGGAGTCTTCATTTGCTGTCTCA ACTGGGGATATCTTCGCTCCTTATGGGATACTCCTGATGATGATATCAATGAAACCCCTCATATATCTTCTCCTCCTCAATTGAAGCAGAGTGATAAGCA AGTGGAGAGGCTACCGGTGTTGATGCCCGGCGACCAATTGCCTAAATTCATAGCCATGGCTTGTCCCTGCAATCCCCCCATATTGGATTTGGAGACGAGG ATTCAAGTACTGAATGTTCATTAG
AA sequence Show only first row Show all	>Lus10032818 pacid=23164801 polypeptide=Lus10032818 locus=Lus10032818.g ID=Lus10032818.BGIv1.0 annot-version=v1.0 MEEDDRTVIGVPVGLALLLVSLFTMTGVFICCLNWGYLRSLWDTPDDDINETPHISSPPQLKQSDKQVERLPVLMPGDQLPKFIAMACPCNPPILDLETR IQVLNVH

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G65660			hydroxyproline-rich glycoprote...		Lus10032818 [exp]	0	1
					Lus10007992 [exp]	1.0	0.9213
AT3G57170			N-acetylglucosaminyl transfera...		Lus10003248 [exp]	3.5	0.8367
AT4G28240			Wound-responsive family protei...		Lus10033728 [exp]	3.5	0.8276
AT2G16700		ADF5, ATADF5	actin depolymerizing factor 5 ...		Lus10025049 [exp]	4.9	0.8128
AT1G58848			Disease resistance protein (CC...		Lus10028076 [exp]	5.5	0.8323
AT1G15520		ATABCG40, ABCG4...	Arabidopsis thaliana ATP-bindi...		Lus10022663 [exp]	5.9	0.8198
AT1G32400		TOM2A	tobamovirus multiplication 2A ...		Lus10040108 [exp]	8.9	0.8180
AT3G62950			Thioredoxin superfamily protei...		Lus10040898 [exp]	9.5	0.8117
AT1G48480		RKL1	receptor-like kinase 1 (.1)		Lus10010973 [exp]	10.8	0.8164
AT1G69360			Plant protein of unknown funct...		Lus10036807 [exp]	11.5	0.7914

Compare expression of checked genes

Lus10032818 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.