Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G24460 133 / 1e-39 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10015572 [exp] 203 / 5e-68 AT5G24460 259 / 6e-87 unknown protein
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.015G002500 [exp] 141 / 1e-42 AT5G24460 246 / 5e-81 unknown protein Potri.010G149800 [exp] 78 / 3e-20 AT5G24460 80 / 3e-19 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10032931 pacid=23160360 polypeptide=Lus10032931 locus=Lus10032931.g ID=Lus10032931.BGIv1.0 annot-version=v1.0 ATGAAGCCCGACGAGAGCCCCGAATCCGCCGTGTTGCGTGCGGTTAGAGAAGAGCTTGGATCGATCGGTGGGGAAGTTAGGATCCTACCTGGTTCGTACA GGGAGAAAGTGGAGGAGAGGTTTTCGGCGTCGTACCCTGGTTTGCCGGCTCGTTATGTTTTGTATTCTGTGGATGCGACGGTGGATGGGTTGCCTGAAGG TGATTTTGCGACGGAAGAAGGAGATGAGTATTTGGAATCTGATGAAAATAAGGTTGCGGACAAAGCTGTGAAAGTTAGGAAGCATTTCTGGAAATGGGTT AGTCCTGATACTGTTCAATTCTGA
AA sequence Show only first row Show all	>Lus10032931 pacid=23160360 polypeptide=Lus10032931 locus=Lus10032931.g ID=Lus10032931.BGIv1.0 annot-version=v1.0 MKPDESPESAVLRAVREELGSIGGEVRILPGSYREKVEERFSASYPGLPARYVLYSVDATVDGLPEGDFATEEGDEYLESDENKVADKAVKVRKHFWKWV SPDTVQF

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G24460			unknown protein		Lus10032931 [exp]	0	1
AT3G16190			Isochorismatase family protein...		Lus10006833 [exp]	1.0	0.8716
AT4G09620			Mitochondrial transcription te...		Lus10009420 [exp]	2.0	0.8540
AT1G07710			Ankyrin repeat family protein ...		Lus10024440 [exp]	8.5	0.8381
AT5G60600		HDS, ISPG, CSB3...	CONSTITUTIVE SUBTILISIN 3, CHL...		Lus10041304 [exp]	10.2	0.7179
AT4G22240			Plastid-lipid associated prote...		Lus10014790 [exp]	16.6	0.8241
AT2G34460			NAD(P)-binding Rossmann-fold s...		Lus10040884 [exp]	16.9	0.7886
AT4G33565			RING/U-box superfamily protein...		Lus10012745 [exp]	17.3	0.8342
AT1G73500		ATMKK9	MAP kinase kinase 9 (.1)		Lus10040128 [exp]	17.7	0.8053
					Lus10020547 [exp]	20.8	0.8002
AT3G07360		ATPUB9	ARABIDOPSIS THALIANA PLANT U-B...		Lus10025885 [exp]	22.4	0.8130

Compare expression of checked genes

Lus10032931 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.