Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G01100 38 / 9e-05 60S acidic ribosomal protein family (.1.2.3.4) AT5G47700 38 / 0.0001 60S acidic ribosomal protein family (.1.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10034864 [exp] 36 / 0.0005 AT5G24510 114 / 2e-34 60S acidic ribosomal protein family (.1)
Poplar homologues Show only best Show top 10	No hit found
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF00428 [flax] [poplar] Ribosomal_60s 60s Acidic ribosomal protein
Representative CDS sequence Show only first row Show all	>Lus10033403 pacid=23172125 polypeptide=Lus10033403 locus=Lus10033403.g ID=Lus10033403.BGIv1.0 annot-version=v1.0 ATGTGCTGGGGTTGTGTAAGTAAGACTCTCACTAAGACCGAGTCTGTTCACCAAGTTGGCCGAGAAGCAAAACATTGCAGACCTTATCATGAACGTTGGT GCTGGCGGTGGCTGTGGTGCTGCTGCCGTTGCTGCTTTGCTGCCCCTGCCGCGGCTCCAGCTGCTGCCGCCGCTGCTCCTGCCGCTGAGGACAAAAAGAA GGAGGAGCCCGAAGTAGAGAGCGATGGTGACCTGGGTTTCTCCCTCTTCGATTAG
AA sequence Show only first row Show all	>Lus10033403 pacid=23172125 polypeptide=Lus10033403 locus=Lus10033403.g ID=Lus10033403.BGIv1.0 annot-version=v1.0 MCWGCVSKTLTKTESVHQVGREAKHCRPYHERWCWRWLWCCCRCCFAAPAAAPAAAAAAPAAEDKKKEEPEVESDGDLGFSLFD

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G47700			60S acidic ribosomal protein f...		Lus10033403 [exp]	0	1
AT1G78980		SRF5	STRUBBELIG-receptor family 5 (...		Lus10037294 [exp]	1.7	0.9515
AT1G78570		ATRHM1, RHM1, R...	REPRESSOR OF LRX1 1, ARABIDOPS...		Lus10010942 [exp]	2.0	0.9216
AT4G19810		ChiC	class V chitinase, Glycosyl hy...		Lus10017124 [exp]	2.4	0.9204
					Lus10039498 [exp]	5.3	0.8593
AT3G24503		ALDH1A, REF1, A...	REDUCED EPIDERMAL FLUORESCENCE...		Lus10023625 [exp]	5.7	0.9001
AT2G24210		AtTPS10	terpene synthase 10 (.1)		Lus10006355 [exp]	6.7	0.8986
AT2G23180		CYP96A1	"cytochrome P450, family 96, s...		Lus10002527 [exp]	9.8	0.8224
AT5G16120			alpha/beta-Hydrolases superfam...		Lus10028475 [exp]	12.6	0.8474
AT1G67290		GLOX1	glyoxal oxidase 1, glyoxal oxi...		Lus10012980 [exp]	14.4	0.8380
AT5G20630		ATGER3, GLP3A, ...	GERMIN-LIKE PROTEIN 3, ARABIDO...		Lus10022020 [exp]	17.7	0.8612

Compare expression of checked genes

Lus10033403 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.