Lus10033670 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10017711 55 / 1e-09 AT1G03760 199 / 2e-59 Prefoldin chaperone subunit family protein (.1)
Poplar homologues

No hit found

PFAM info
Representative CDS sequence
>Lus10033670 pacid=23143340 polypeptide=Lus10033670 locus=Lus10033670.g ID=Lus10033670.BGIv1.0 annot-version=v1.0
ATGGGTCAAGAGACTAGAGCTAGAGGTGATGTTCTTGTAATAAGTGATCTAGCATTTCTGTGGCTAATAAAATACACCTACCAGCAAAGGAAACCACGGG
AGCAGGCGAAAATTGAGGATCTAACTGCTGAAGTATTATCCAATAAGTATCAGAGCCACTTGAGTCTAAATGACGAGCAAAGTGCTTCCATGGGTTCTAT
TGTAGATTGCAACGACAGCAGACAAACAAACCCTGTGGCCTCAAGCTCTGATTTTGACAGCTCTAAGGCTTTTCCGGGCTCCATTGTCGAACGTTCAACC
GAAGTATTTAACACATCAAATTCTGCAAGTTCACAGGTTCAAGATGCAGAGAAGATAGTTGCAGCATCGATGTCCATGATAGTGTAG
AA sequence
>Lus10033670 pacid=23143340 polypeptide=Lus10033670 locus=Lus10033670.g ID=Lus10033670.BGIv1.0 annot-version=v1.0
MGQETRARGDVLVISDLAFLWLIKYTYQQRKPREQAKIEDLTAEVLSNKYQSHLSLNDEQSASMGSIVDCNDSRQTNPVASSSDFDSSKAFPGSIVERST
EVFNTSNSASSQVQDAEKIVAASMSMIV

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
Lus10033670 0 1
AT3G22660 rRNA processing protein-relate... Lus10036936 11.9 0.7575
AT2G37860 LCD1 LOWER CELL DENSITY 1, Protein ... Lus10024346 15.0 0.7162
AT1G65280 DNAJ heat shock N-terminal dom... Lus10017919 19.1 0.7471
AT5G18475 Pentatricopeptide repeat (PPR)... Lus10041927 27.5 0.7099
AT2G18400 ribosomal protein L6 family pr... Lus10014306 30.7 0.7121
AT1G16000 unknown protein Lus10011478 34.2 0.7061
AT5G38890 Nucleic acid-binding, OB-fold-... Lus10004763 37.4 0.7122
AT5G04280 AtRZ-1c AtRZ-1c, RNA-binding (RRM/RBD/... Lus10037950 40.1 0.7078
Lus10003566 49.7 0.7028
AT3G47120 C3HZnF RNA recognition motif (RRM)-co... Lus10018227 53.1 0.7117

Lus10033670 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.