Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10041460 [exp] 158 / 3e-51 AT3G25882 51 / 3e-09 NIM1-interacting 2 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.010G125900 [exp] 41 / 2e-05 ND / Potri.008G119900 [exp] 39 / 0.0001 ND /
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10034312 pacid=23176097 polypeptide=Lus10034312 locus=Lus10034312.g ID=Lus10034312.BGIv1.0 annot-version=v1.0 ATGGAAGCACCGACGGCCGGCAAGAAAACCAGGAAACGACCACCGGCGGAAGTCGAATCTACAACTCCGGAGAAGGAAATCCGATCGCCGATGGCCAGGG CGGTGCCGGAGGAAGAGGTGGAGGAATTCTTTGCGATATTGAGGAGGATTCACGTTGCCGTTAAGTACTTCAAGAGGAGCGGCGGCAGCGGCGGAGAGAA CAGGAAGAGATGCCTGCCATCGTTTGACAGGGAGGCCGATTTGGAGGAGATCGACGGCGGCGGGGAAAACGATGTGCAGGTGGCGTTTGACGGAGAGGCG AGTAAAGCGGTTGTGGAGGAAGTGGGTTTGGATCTGAATTTGGATCCTCCTCCGGATCTAACTTCCGATGATAATTAG
AA sequence Show only first row Show all	>Lus10034312 pacid=23176097 polypeptide=Lus10034312 locus=Lus10034312.g ID=Lus10034312.BGIv1.0 annot-version=v1.0 MEAPTAGKKTRKRPPAEVESTTPEKEIRSPMARAVPEEEVEEFFAILRRIHVAVKYFKRSGGSGGENRKRCLPSFDREADLEEIDGGGENDVQVAFDGEA SKAVVEEVGLDLNLDPPPDLTSDDN

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G25882		NIMIN-2	NIM1-interacting 2 (.1)		Lus10034312 [exp]	0	1
AT2G17230		EXL5	EXORDIUM like 5 (.1)		Lus10026548 [exp]	4.1	0.8020
AT2G17120		LYM2	lysm domain GPI-anchored prote...		Lus10014442 [exp]	9.8	0.7448
AT4G32300		SD2-5	S-domain-2 5 (.1)		Lus10043391 [exp]	11.2	0.7651
AT3G44480		COG1, RPP10, RP...	recognition of peronospora par...		Lus10005813 [exp]	11.8	0.7714
AT5G15650		REVERSIBLYGLYCO...	reversibly glycosylated polype...		Lus10034665 [exp]	12.3	0.7737
AT2G17230		EXL5	EXORDIUM like 5 (.1)		Lus10013834 [exp]	12.6	0.7947
AT5G26670			Pectinacetylesterase family pr...		Lus10010084 [exp]	13.6	0.7691
AT3G05370		AtRLP31	receptor like protein 31 (.1)		Lus10000228 [exp]	16.7	0.7636
AT3G60580	C2H2ZnF		C2H2-like zinc finger protein ...		Lus10004724 [exp]	17.8	0.7901
AT3G54810	GATA	GATA8, BME3, BM...	GATA TRANSCRIPTION FACTOR 8, B...		Lus10009227 [exp]	22.2	0.7532

Compare expression of checked genes

Lus10034312 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.