Lus10034427 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT1G14730 259 / 3e-88 Cytochrome b561/ferric reductase transmembrane protein family (.1)
AT5G38630 145 / 5e-43 ACYB-1 cytochrome B561-1 (.1)
AT4G25570 142 / 9e-42 ACYB-2 Cytochrome b561/ferric reductase transmembrane protein family (.1)
AT1G26100 83 / 3e-19 Cytochrome b561/ferric reductase transmembrane protein family (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10031935 336 / 2e-118 AT1G14730 284 / 8e-98 Cytochrome b561/ferric reductase transmembrane protein family (.1)
Lus10019135 233 / 4e-78 AT1G14730 177 / 2e-56 Cytochrome b561/ferric reductase transmembrane protein family (.1)
Lus10035096 238 / 9e-75 AT2G02010 835 / 0.0 glutamate decarboxylase 4 (.1)
Lus10039216 154 / 8e-47 AT4G25570 305 / 6e-106 Cytochrome b561/ferric reductase transmembrane protein family (.1)
Lus10028996 145 / 4e-43 AT4G25570 145 / 4e-43 Cytochrome b561/ferric reductase transmembrane protein family (.1)
Lus10014986 136 / 5e-39 AT4G25570 331 / 8e-115 Cytochrome b561/ferric reductase transmembrane protein family (.1)
Lus10038866 134 / 1e-38 AT4G25570 326 / 3e-114 Cytochrome b561/ferric reductase transmembrane protein family (.1)
Lus10027461 132 / 1e-37 AT4G25570 287 / 3e-98 Cytochrome b561/ferric reductase transmembrane protein family (.1)
Lus10003682 123 / 1e-34 AT4G25570 131 / 1e-37 Cytochrome b561/ferric reductase transmembrane protein family (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.010G102400 295 / 4e-102 AT1G14730 271 / 7e-93 Cytochrome b561/ferric reductase transmembrane protein family (.1)
Potri.008G138300 289 / 5e-100 AT1G14730 252 / 2e-85 Cytochrome b561/ferric reductase transmembrane protein family (.1)
Potri.015G143700 157 / 8e-48 AT4G25570 297 / 8e-103 Cytochrome b561/ferric reductase transmembrane protein family (.1)
Potri.012G141000 150 / 4e-45 AT4G25570 254 / 5e-86 Cytochrome b561/ferric reductase transmembrane protein family (.1)
Potri.004G103800 139 / 8e-41 AT5G38630 301 / 2e-104 cytochrome B561-1 (.1)
Potri.017G111700 136 / 1e-39 AT5G38630 321 / 2e-112 cytochrome B561-1 (.1)
Potri.008G115300 130 / 2e-37 AT5G38630 272 / 7e-93 cytochrome B561-1 (.1)
Potri.008G115200 86 / 3e-20 AT1G26100 270 / 6e-92 Cytochrome b561/ferric reductase transmembrane protein family (.1)
Potri.010G131100 84 / 1e-19 AT1G26100 270 / 6e-92 Cytochrome b561/ferric reductase transmembrane protein family (.1)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
CL0328 2heme_cytochrom PF03188 Cytochrom_B561 Eukaryotic cytochrome b561
Representative CDS sequence
>Lus10034427 pacid=23176051 polypeptide=Lus10034427 locus=Lus10034427.g ID=Lus10034427.BGIv1.0 annot-version=v1.0
ATGGAGACAGGGGTGGTATACAGGAGGTCTGCATCTGGGCTGACGGTAGGTGCTCACGTGTTTGGGATACTAGGGATCATACTGATGCTGGTGTGGTTGC
TTCACTTCCGTGAAGGCATTGAGTATGATTCTGACAACCCAGCTCGCGTCTTCAATGTTCATCCATTCCTCATGTTCTGCGGATTCATCTTCCTCGATGG
TCAAGCTATGATGGCATACAAGTCTGTGCCGGCGGCGAGAGAAGCACAGAAGGCAGTGCACATGGTCCTGAACCTAGTCGGAATAGCACTAGGGATCGCC
GGAATAAGCGCGGCGTTCAGGTTCCATGACATGGTGAACTCGGAGGACATGTACAGCCTTCATTCCTGGATAGGCCTCACCACATTCTGCCTGGTCGGGC
TCCAGTGGCTCCTCGGATGTTTCACCTACATGTTCCCCAAGGCCAGTCAGGGGACGCGTGGCAGCATGCTGGCATGGCACATCAGCGGCGGCAGGGCCCT
GCTGTACATGGCAATCTGCGCCGCCCTCACCGGACTCATGGAGAAGTCCAGCATCCTACGGCTCCAAGGATACGGCGAGGCCAGGCTCGTCAACTTCATT
GGACTCTGCATCTTACTCTTCGGCATCTTCGTTGACCTTTCTGTTGCTCTGGCTCATCATGCCTAG
AA sequence
>Lus10034427 pacid=23176051 polypeptide=Lus10034427 locus=Lus10034427.g ID=Lus10034427.BGIv1.0 annot-version=v1.0
METGVVYRRSASGLTVGAHVFGILGIILMLVWLLHFREGIEYDSDNPARVFNVHPFLMFCGFIFLDGQAMMAYKSVPAAREAQKAVHMVLNLVGIALGIA
GISAAFRFHDMVNSEDMYSLHSWIGLTTFCLVGLQWLLGCFTYMFPKASQGTRGSMLAWHISGGRALLYMAICAALTGLMEKSSILRLQGYGEARLVNFI
GLCILLFGIFVDLSVALAHHA

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT1G14730 Cytochrome b561/ferric reducta... Lus10034427 0 1
AT1G14730 Cytochrome b561/ferric reducta... Lus10031935 2.2 0.9576
AT5G22870 Late embryogenesis abundant (L... Lus10016161 4.0 0.9461
AT1G79480 Carbohydrate-binding X8 domain... Lus10001764 4.9 0.9268
AT5G22870 Late embryogenesis abundant (L... Lus10021404 5.2 0.9348
AT5G50790 SWEET10, AtSWEE... Nodulin MtN3 family protein (.... Lus10022436 7.8 0.8498
AT4G25140 OLE1, OLEO1 oleosin 1 (.1) Lus10022141 8.5 0.9096
AT5G03795 Exostosin family protein (.1) Lus10025178 11.8 0.8727
AT3G20570 AtENODL9 early nodulin-like protein 9 (... Lus10011158 12.8 0.9251
AT5G04890 RTM2 RESTRICTED TEV MOVEMENT 2, HSP... Lus10028874 14.3 0.9197
AT3G26350 unknown protein Lus10006464 14.5 0.9084

Lus10034427 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.