Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G49601 60 / 1e-11 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10008501 [exp] 87 / 3e-21 AT3G49601 209 / 2e-57 unknown protein Lus10000736 [exp] 87 / 3e-21 AT3G49601 207 / 2e-57 unknown protein
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.006G233000 [exp] 74 / 2e-16 AT3G49601 201 / 1e-55 unknown protein
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF08312 [flax] [poplar] cwf21 cwf21 domain
Representative CDS sequence Show only first row Show all	>Lus10034691 pacid=23162737 polypeptide=Lus10034691 locus=Lus10034691.g ID=Lus10034691.BGIv1.0 annot-version=v1.0 ATGTCAACAAGGACATCCTTGAGCACTACCGCAAAGCGAAAAATTCAACTCAAGCTCGTGGTGCTTGCAGATAAGCTGATTGATCAAGGTTTTACTGATG CTGAGATTGTTGAGAAGCTGGAGGAAGCTAGGGGGATTTTGGACGCGGCTTCCGCCTTTGAGGAAAGTGGTGGATCGGGGGTTGCTCATACCTCCAAGGG ATTTGGTGAAGACCATGGTACTGCAGGTATTGCAAAAAAGCCCAACAAGGACATCCTTGAGAATAACCGCAAGCGGCAAGTTCAACTCAAGCTCTTGGTG CTTGAAGATAAGTTGATTGATTAA
AA sequence Show only first row Show all	>Lus10034691 pacid=23162737 polypeptide=Lus10034691 locus=Lus10034691.g ID=Lus10034691.BGIv1.0 annot-version=v1.0 MSTRTSLSTTAKRKIQLKLVVLADKLIDQGFTDAEIVEKLEEARGILDAASAFEESGGSGVAHTSKGFGEDHGTAGIAKKPNKDILENNRKRQVQLKLLV LEDKLID

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G49601			unknown protein		Lus10034691 [exp]	0	1
AT1G73990		SPPA1, SPPA	signal peptide peptidase (.1)		Lus10013333 [exp]	1.0	0.9629
AT5G27700			Ribosomal protein S21e (.1)		Lus10010971 [exp]	1.4	0.9310
AT2G36780			UDP-Glycosyltransferase superf...		Lus10027739 [exp]	6.0	0.8953
					Lus10036060 [exp]	7.7	0.8598
AT4G12545			Bifunctional inhibitor/lipid-t...		Lus10024624 [exp]	8.1	0.9004
AT5G61000		ATRPA70D	Replication factor-A protein 1...		Lus10003025 [exp]	9.2	0.8860
AT5G12060			Plant self-incompatibility pro...		Lus10023195 [exp]	11.7	0.8795
AT5G17600			RING/U-box superfamily protein...		Lus10008458 [exp]	12.7	0.8795
AT4G10850		SWEET7, AtSWEET...	Nodulin MtN3 family protein (....		Lus10023047 [exp]	13.6	0.8795
AT4G35610	C2H2ZnF		zinc finger (C2H2 type) family...		Lus10035994 [exp]	14.4	0.8778

Compare expression of checked genes

Lus10034691 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.