Lus10034841 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT1G51650 113 / 2e-34 ATP synthase epsilon chain, mitochondrial (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10035755 125 / 6e-39 AT1G51650 112 / 2e-34 ATP synthase epsilon chain, mitochondrial (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.008G008900 108 / 4e-32 AT1G51650 122 / 2e-38 ATP synthase epsilon chain, mitochondrial (.1)
Potri.010G250000 108 / 4e-32 AT1G51650 122 / 1e-38 ATP synthase epsilon chain, mitochondrial (.1)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
PF04627 ATP-synt_Eps Mitochondrial ATP synthase epsilon chain
Representative CDS sequence
>Lus10034841 pacid=23142306 polypeptide=Lus10034841 locus=Lus10034841.g ID=Lus10034841.BGIv1.0 annot-version=v1.0
ATGAAAATAAATGGACGTCCTGCTAACTCGGAGCTTTTTGTTGCGGCTAAAAGAAATTCCGACGAACTGAAGAGAGCAAAGAGACGACCGAAGAAAGTAA
GAAAGAAAGAGCTCGGACCAATGGCGTCGACTGCAGCAGTGCCTTTCTGGAGGTCCGCAGGGATGACCTACATAACCTACTCAAACATCTGCGCCAACTT
AGTCAGGAACTCTCTCAAGGAGCCATTCAAGGCTGAAGCCCTAGCTCGGGAGAAGGTCCATTTCTCCGTTGCAAAGTGGGCTGAAGGAAAACCCCAGAAA
CCCAGTAAGATTTCCCTTGCCCATCTGTTTTTTTTTCTTTCTTTCTTCGCTTAG
AA sequence
>Lus10034841 pacid=23142306 polypeptide=Lus10034841 locus=Lus10034841.g ID=Lus10034841.BGIv1.0 annot-version=v1.0
MKINGRPANSELFVAAKRNSDELKRAKRRPKKVRKKELGPMASTAAVPFWRSAGMTYITYSNICANLVRNSLKEPFKAEALAREKVHFSVAKWAEGKPQK
PSKISLAHLFFFLSFFA

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT1G51650 ATP synthase epsilon chain, mi... Lus10034841 0 1
AT1G71150 unknown protein Lus10021799 1.0 0.8084
AT3G50860 Clathrin adaptor complex small... Lus10041742 1.4 0.7953
AT5G40080 Mitochondrial ribosomal protei... Lus10034241 4.9 0.7273
AT1G55020 ATLOX1, LOX1 ARABIDOPSIS LIPOXYGENASE 1, li... Lus10001465 6.6 0.7662
AT5G16060 Cytochrome c oxidase biogenesi... Lus10033547 9.2 0.7843
AT1G67000 Protein kinase superfamily pro... Lus10026761 11.5 0.7222
AT4G26590 ATOPT5 ARABIDOPSIS THALIANA OLIGOPEPT... Lus10014885 13.4 0.7139
AT5G18910 Protein kinase superfamily pro... Lus10012776 15.0 0.6631
AT5G16060 Cytochrome c oxidase biogenesi... Lus10017586 15.0 0.7076
AT5G42560 Abscisic acid-responsive (TB2/... Lus10024332 16.4 0.6218

Lus10034841 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.