Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G51650 111 / 6e-34 ATP synthase epsilon chain, mitochondrial (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10034841 [exp] 127 / 1e-39 AT1G51650 114 / 1e-34 ATP synthase epsilon chain, mitochondrial (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.008G008900 [exp] 104 / 2e-31 AT1G51650 122 / 2e-38 ATP synthase epsilon chain, mitochondrial (.1) Potri.010G250000 [exp] 104 / 2e-31 AT1G51650 122 / 1e-38 ATP synthase epsilon chain, mitochondrial (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF04627 [flax] [poplar] ATP-synt_Eps Mitochondrial ATP synthase epsilon chain
Representative CDS sequence Show only first row Show all	>Lus10035755 pacid=23147498 polypeptide=Lus10035755 locus=Lus10035755.g ID=Lus10035755.BGIv1.0 annot-version=v1.0 ATGGCGTCGACGGCAGCAGTGCCCTTTTGGAGGTCTGCAGGGATGACTTACATCACTTACTCAAACCTCTGCGCTAACATAGTCAGGAACTCCCTCAAGG AACCCTTCAAGGGTGAAGCCCTCGCAAGGGAGAAGGTTCATTTCTCCGTCGCCAAATGGGCTGAGGGGAAACCCCAGAAACCCACTGATGCACATCTGGT TTTGATGCACTTGTTGAATTTTGATTGCGGTTGCTTCATTGCTTGA
AA sequence Show only first row Show all	>Lus10035755 pacid=23147498 polypeptide=Lus10035755 locus=Lus10035755.g ID=Lus10035755.BGIv1.0 annot-version=v1.0 MASTAAVPFWRSAGMTYITYSNLCANIVRNSLKEPFKGEALAREKVHFSVAKWAEGKPQKPTDAHLVLMHLLNFDCGCFIA

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G51650			ATP synthase epsilon chain, mi...		Lus10035755 [exp]	0	1
AT2G19790			SNARE-like superfamily protein...		Lus10012924 [exp]	1.4	0.9088
AT1G05205			unknown protein		Lus10039669 [exp]	7.1	0.8819
AT1G22520			Domain of unknown function (DU...		Lus10009454 [exp]	9.8	0.8862
AT4G30010			unknown protein		Lus10025458 [exp]	11.4	0.8662
AT4G34840		ATMTN2, ATMTAN2	ARABIDOPSIS METHYLTHIOADENOSIN...		Lus10042387 [exp]	13.0	0.8714
AT5G20570		HRT1, ROC1, RBX...	REGULATOR OF CULLINS-1, RING-b...		Lus10015667 [exp]	14.0	0.8784
AT4G30010			unknown protein		Lus10001443 [exp]	17.0	0.8693
AT3G05545			RING/U-box superfamily protein...		Lus10020655 [exp]	17.5	0.8731
AT3G52730			ubiquinol-cytochrome C reducta...		Lus10014198 [exp]	20.3	0.8565
					Lus10041954 [exp]	21.1	0.8759

Compare expression of checked genes

Lus10035755 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.