Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G52050 122 / 1e-34 5'-3' exonuclease family protein (.1.2.3.4.5)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10025723 [exp] 169 / 7e-55 AT3G52050 307 / 2e-104 5'-3' exonuclease family protein (.1.2.3.4.5)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.013G125700 [exp] 122 / 7e-35 AT3G52050 510 / 1e-180 5'-3' exonuclease family protein (.1.2.3.4.5)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10035938 pacid=23141042 polypeptide=Lus10035938 locus=Lus10035938.g ID=Lus10035938.BGIv1.0 annot-version=v1.0 ATGGACATTAAGGTCATCGAGGCCCTGATAACGCATGCTGATCAGGCTGTATTAAGCAAGGAACTGGCGATGCTACGTTGTGATCTCCCATATTACATGG TTCCATTCAACACTGAAGATCTAGAGTTTAAGAGACCAGAGGACAATGGTGAGAAGTTTACGAGTTTACTGAATGCTATCAGTGCATATGCGGAAGGATT TTCAGCCGATCCTATCATAAGACGAGCTTCCTATCTGTGGAAGAAGCTTGACGCTTCTTCTTCTTAG
AA sequence Show only first row Show all	>Lus10035938 pacid=23141042 polypeptide=Lus10035938 locus=Lus10035938.g ID=Lus10035938.BGIv1.0 annot-version=v1.0 MDIKVIEALITHADQAVLSKELAMLRCDLPYYMVPFNTEDLEFKRPEDNGEKFTSLLNAISAYAEGFSADPIIRRASYLWKKLDASSS

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G52050			5'-3' exonuclease family prote...		Lus10035938 [exp]	0	1
AT5G60335			Thioesterase superfamily prote...		Lus10028483 [exp]	3.7	0.8235
AT3G52040			unknown protein		Lus10005332 [exp]	6.7	0.7628
AT4G08460			Protein of unknown function (D...		Lus10024758 [exp]	9.2	0.7863
AT3G10670		ABCI6, ATNAP7	ATP-binding cassette I6, non-i...		Lus10034152 [exp]	9.9	0.7740
AT3G16190			Isochorismatase family protein...		Lus10037581 [exp]	10.0	0.7900
AT5G60335			Thioesterase superfamily prote...		Lus10009162 [exp]	15.0	0.7811
AT4G37020			unknown protein		Lus10000435 [exp]	16.6	0.7896
AT2G28230			TATA-binding related factor (T...		Lus10030830 [exp]	18.8	0.7875
AT2G38280		ATAMPD, FAC1	EMBRYONIC FACTOR1, ADENOSINE 5...		Lus10005043 [exp]	21.8	0.7492
AT5G20180			Ribosomal protein L36 (.1.2)		Lus10019412 [exp]	22.6	0.7552

Compare expression of checked genes

Lus10035938 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.