Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G31170 64 / 3e-14 ATSRX sulfiredoxin (.1.2.3.4)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10038354 [exp] 99 / 1e-27 AT1G31170 67 / 2e-15 sulfiredoxin (.1.2.3.4) Lus10038353 [exp] 50 / 5e-08 AT2G35110 1796 / 0.0 NCK-ASSOCIATED PROTEIN 1, GNARLED, transcription activators (.1.2)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.012G124500 [exp] 80 / 3e-20 AT1G31170 176 / 4e-58 sulfiredoxin (.1.2.3.4)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10036218 pacid=23169348 polypeptide=Lus10036218 locus=Lus10036218.g ID=Lus10036218.BGIv1.0 annot-version=v1.0 ATGGCAAACCTGATTCTGCGAGTACCGGCGGGTAGCAACCTCAGGGGATTCTCTGTAGCGGCGTCTTCTTCTTCGTCTAATGGAGCTGCTCCAGGGAGCA TGCAGAAGAAGGGGCCGATGATAGTGGAGATAGCGTTGGATCAGATAAAGAGGCCATTGATGCGAACCAGAGCGAATGATCCAGCCAAGGTCCAAGAACT CATGCACAGCATCCACCAAATCGGCCTCCAAGTCCCTGACCATACCTCGGCGCTGCAAACCTCTGCACTGGTCTCGCCGAACCTGAACACCCTTCCGTGT GTTTCACTTTCTGGCTTGAGTTGTAATCCAGTGGTCCAGACCGCCGCACATTTCTAG
AA sequence Show only first row Show all	>Lus10036218 pacid=23169348 polypeptide=Lus10036218 locus=Lus10036218.g ID=Lus10036218.BGIv1.0 annot-version=v1.0 MANLILRVPAGSNLRGFSVAASSSSSNGAAPGSMQKKGPMIVEIALDQIKRPLMRTRANDPAKVQELMHSIHQIGLQVPDHTSALQTSALVSPNLNTLPC VSLSGLSCNPVVQTAAHF

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G31170		ATSRX	sulfiredoxin (.1.2.3.4)		Lus10036218 [exp]	0	1
AT1G65230			Uncharacterized conserved prot...		Lus10020202 [exp]	2.8	0.9362
AT1G61600			Protein of unknown function (D...		Lus10031916 [exp]	5.7	0.8955
AT1G65230			Uncharacterized conserved prot...		Lus10027002 [exp]	7.3	0.8977
AT2G41200			unknown protein		Lus10008568 [exp]	8.0	0.8796
AT2G39000			Acyl-CoA N-acyltransferases (N...		Lus10009229 [exp]	8.9	0.8925
AT5G53560		B5#2, ATB5-A, A...	ARABIDOPSIS CYTOCHROME B5 ISOF...		Lus10030219 [exp]	9.8	0.8228
AT4G40070			RING/U-box superfamily protein...		Lus10034157 [exp]	10.4	0.8845
AT2G41200			unknown protein		Lus10032687 [exp]	12.0	0.8719
AT3G14630		CYP72A9	"cytochrome P450, family 72, s...		Lus10002311 [exp]	12.2	0.8595
AT3G02730		TRXF1, ATF1	thioredoxin F-type 1 (.1)		Lus10020199 [exp]	13.6	0.8877

Compare expression of checked genes

Lus10036218 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.