Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G58005 145 / 1e-46 Cytochrome c oxidase, subunit Vib family protein (.1.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10021847 [exp] 220 / 3e-76 AT5G58005 150 / 3e-48 Cytochrome c oxidase, subunit Vib family protein (.1.2)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.018G109400 [exp] 147 / 4e-47 AT5G58005 174 / 1e-57 Cytochrome c oxidase, subunit Vib family protein (.1.2) Potri.006G186500 [exp] 145 / 1e-46 AT5G58005 173 / 1e-57 Cytochrome c oxidase, subunit Vib family protein (.1.2)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0351 [flax] [poplar] CHCH PF02297 [flax] [poplar] COX6B Cytochrome oxidase c subunit VIb
Representative CDS sequence Show only first row Show all	>Lus10036285 pacid=23169357 polypeptide=Lus10036285 locus=Lus10036285.g ID=Lus10036285.BGIv1.0 annot-version=v1.0 ATGTCGGCGACGGAATCAAGAAACCCTGATCATGTTCACGCCGACGTGCTCTTGCAAGCCAGAGAAGCTTGCTACAAGGCTCGTGATACTTTCTACTCTT GTCTAGAGAATCAATCGGGGAAGAAGCTGACGGAGAACGGATGCGTCGGGTTGCTTTACCCGACCGAGTGCAAAGCCTCAAGAATTGATTACGAGAACAG CTGTCGAGCTTCTTGGGTGAAGCATTTCGATAGGCTGTATTGTAAGGAGAAGAAGGTGCAGAGGCTATTGGACGACAAGGACACCAGGAGAGGCCCTTTG ATACTTGCACAGCAACAAACCAATTAA
AA sequence Show only first row Show all	>Lus10036285 pacid=23169357 polypeptide=Lus10036285 locus=Lus10036285.g ID=Lus10036285.BGIv1.0 annot-version=v1.0 MSATESRNPDHVHADVLLQAREACYKARDTFYSCLENQSGKKLTENGCVGLLYPTECKASRIDYENSCRASWVKHFDRLYCKEKKVQRLLDDKDTRRGPL ILAQQQTN

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G58005			Cytochrome c oxidase, subunit ...		Lus10036285 [exp]	0	1
AT1G78790			unknown protein		Lus10042781 [exp]	4.0	0.7503
AT4G29170		ATMND1	Mnd1 family protein (.1.2)		Lus10002503 [exp]	7.2	0.7698
AT1G01940			Cyclophilin-like peptidyl-prol...		Lus10009237 [exp]	7.6	0.7801
AT1G10865			unknown protein		Lus10032774 [exp]	9.5	0.7498
AT1G64970		VTE4, TMT1, G-T...	VITAMIN E DEFICIENT 4, gamma-t...		Lus10020357 [exp]	9.5	0.7365
AT2G02570			nucleic acid binding;RNA bindi...		Lus10007436 [exp]	9.8	0.7806
AT5G09920		NRPB4, ATRPB15....	RNA polymerase II, Rpb4, core ...		Lus10005796 [exp]	14.4	0.7498
AT3G05250			RING/U-box superfamily protein...		Lus10029940 [exp]	15.2	0.7181
AT2G11520		CRCK3	calmodulin-binding receptor-li...		Lus10041796 [exp]	21.2	0.7672
AT5G05670			signal recognition particle bi...		Lus10030593 [exp]	21.4	0.7228

Compare expression of checked genes

Lus10036285 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.