Lus10036400 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Poplar homologues

No hit found

PFAM info
Representative CDS sequence
>Lus10036400 pacid=23174382 polypeptide=Lus10036400 locus=Lus10036400.g ID=Lus10036400.BGIv1.0 annot-version=v1.0
ATGATCATGAGGAGCTCAATCTTAGCTCCAACAACTAATCTCTATAGGATTGGGGTGGTTGGTGACAATGATTTTGGGAGGGCATTGCTTGACCCGAACT
CTCTTGACCGATTTACTAGCTCCACCGCTGCCTATGAGTTACCGACTCATCCTTCAAAAGACATGCATGCAGTTAGATTCGCAAACCACTTAGGAGCTTA
CGGTTTCATGTTCTATTTCACTCCCCTCACGGATTCCCCTGCTGCTGTTTTGACTGCTTTGGAAGTGATAAACAGAACGCGTCAGTTTTCGGAAAACGGA
ACTTCAACAAGGATCATATTCTCGGATTAA
AA sequence
>Lus10036400 pacid=23174382 polypeptide=Lus10036400 locus=Lus10036400.g ID=Lus10036400.BGIv1.0 annot-version=v1.0
MIMRSSILAPTTNLYRIGVVGDNDFGRALLDPNSLDRFTSSTAAYELPTHPSKDMHAVRFANHLGAYGFMFYFTPLTDSPAAVLTALEVINRTRQFSENG
TSTRIIFSD

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
Lus10036400 0 1
AT2G37900 Major facilitator superfamily ... Lus10012663 7.7 0.8995
Lus10041251 11.4 0.8941
AT1G49000 unknown protein Lus10032453 14.7 0.8688
AT1G31320 AS2 LBD4 LOB domain-containing protein ... Lus10018275 16.2 0.8401
Lus10042011 17.2 0.8741
AT4G01250 WRKY ATWRKY22, WRKY2... WRKY family transcription fact... Lus10007907 19.3 0.8820
AT1G31490 HXXXD-type acyl-transferase fa... Lus10023806 24.2 0.8696
AT4G24910 Protein of unknown function (D... Lus10002345 24.7 0.8749
AT2G36300 Integral membrane Yip1 family ... Lus10021374 35.3 0.8633
AT4G24910 Protein of unknown function (D... Lus10003160 37.3 0.8683

Lus10036400 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.