Plant FIBer expression Database

Lus10036572 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT5G66550 72 / 7e-17 Maf-like protein (.1)
AT2G25500 50 / 3e-09 Inosine triphosphate pyrophosphatase family protein (.1)
AT5G42770 49 / 3e-08 Maf-like protein (.1.2)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10040204
[exp]
105 / 7e-31 AT5G66550 154 / 2e-48 Maf-like protein (.1)
Lus10040470
[exp]
103 / 3e-29 AT5G66550 268 / 3e-92 Maf-like protein (.1)
Lus10002531
[exp]
56 / 1e-10 AT5G42770 307 / 8e-107 Maf-like protein (.1.2)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.007G025000
[exp]
62 / 6e-13 AT5G66550 278 / 1e-95 Maf-like protein (.1)
Potri.014G196400
[exp]
59 / 7e-12 AT5G42770 309 / 2e-107 Maf-like protein (.1.2)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
CL0269 Maf PF02545 Maf Maf-like protein
Representative CDS sequence
>Lus10036572 pacid=23174476 polypeptide=Lus10036572 locus=Lus10036572.g ID=Lus10036572.BGIv1.0 annot-version=v1.0
ATGGCCCTAGCTGAGGGTAAGGCAGATGCCATGGTAGCAAAGCTGCCGAACACAGACCAACTGAACAACTATAGTGATCCTACAGTGTTGACTACTGCAG
ATACGGTTGTGGTATACAAAGGAGTAGTGAAAGAGAAGCCAACCAGCGAGGAAGAAGCGCGGGAATTCATCAACCAGCGAGGAAGAAGCGCGGGAATTCA
TCAACCAGCGAGGAAGAAGCGCGGGAATTCATCAACCAGCGAGGAAGAAGCGCGGGAATTCATCAACCAGCGAAGAAGAAGCGCGGGAATTCTTTGA
AA sequence
>Lus10036572 pacid=23174476 polypeptide=Lus10036572 locus=Lus10036572.g ID=Lus10036572.BGIv1.0 annot-version=v1.0
MALAEGKADAMVAKLPNTDQLNNYSDPTVLTTADTVVVYKGVVKEKPTSEEEAREFINQRGRSAGIHQPARKKRGNSSTSEEEAREFINQRRRSAGIL

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT5G66550 Maf-like protein (.1) Lus10036572
[exp]
0 1
AT2G24050 eIFiso4G2 eukaryotic translation Initiat... Lus10036256
[exp]
1.0 0.9414
Lus10021782
[exp]
8.7 0.9244
AT4G37740 GRF ATGRF2 growth-regulating factor 2 (.1... Lus10008916
[exp]
9.3 0.7458
AT5G38530 TSBtype2 tryptophan synthase beta type ... Lus10012746
[exp]
9.5 0.8332
AT1G74670 GASA6 GA-stimulated Arabidopsis 6, G... Lus10024216
[exp]
10.7 0.9244
AT2G25470 AtRLP21 receptor like protein 21 (.1) Lus10027855
[exp]
12.3 0.9244
AT3G20800 Cell differentiation, Rcd1-lik... Lus10031542
[exp]
13.8 0.9244
AT1G17930 Aminotransferase-like, plant m... Lus10016922
[exp]
15.1 0.9244
AT2G34320 Polynucleotidyl transferase, r... Lus10039942
[exp]
16.3 0.9244
AT4G12570 UPL5 ubiquitin protein ligase 5 (.1... Lus10039026
[exp]
17.4 0.9244

Lus10036572 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.