Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G50750 45 / 3e-06 Plant mobile domain protein family (.1) AT1G48120 42 / 3e-05 hydrolases;protein serine/threonine phosphatases (.1) AT1G32120 40 / 0.0001 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10003728 [exp] 171 / 6e-56 AT2G04865 54 / 5e-09 Aminotransferase-like, plant mobile domain family protein (.1) Lus10033216 [exp] 174 / 2e-54 AT1G48120 41 / 0.002 hydrolases;protein serine/threonine phosphatases (.1) Lus10033204 [exp] 170 / 3e-54 AT2G25010 50 / 4e-07 Aminotransferase-like, plant mobile domain family protein (.1) Lus10000607 [exp] 169 / 4e-54 AT2G25010 47 / 4e-06 Aminotransferase-like, plant mobile domain family protein (.1) Lus10005722 [exp] 151 / 1e-47 ND / Lus10000720 [exp] 139 / 2e-43 AT1G17930 56 / 1e-09 Aminotransferase-like, plant mobile domain family protein (.1) Lus10033921 [exp] 132 / 4e-41 ND 39 / 5e-04 Lus10006530 [exp] 130 / 1e-39 ND / Lus10010058 [exp] 129 / 2e-39 ND 36 / 0.007
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.004G068801 [exp] 36 / 0.001 AT1G48120 48 / 2e-07 hydrolases;protein serine/threonine phosphatases (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF10536 [flax] [poplar] PMD Plant mobile domain
Representative CDS sequence Show only first row Show all	>Lus10036654 pacid=23174441 polypeptide=Lus10036654 locus=Lus10036654.g ID=Lus10036654.BGIv1.0 annot-version=v1.0 ATGTCGATCCCGGCACCACGTGCTAGTGGGGAGGCACTTGCTGGGAGTTGGGACGGACTGAGAATCGTTGAGAGAGCAGCTGATGCGGATACGAGGCTAG ACACACTACGATCGACTATGGATGGGATGATGCACGCCCACGTCGATTGGCTTCCGTTCGGTACACCTGACTTCGACGGTGAGGCTCGGTGGTCCTTGTA CAGTGGAGGCATACATGGATTCGACTACATTGAGCCGTACGGTCCCAACCGCGTGTTGCGTCAGTACGGCTACCAACAGACGATCCCGAATTCAATTCTC ACGCCGGAGTTAGCGTCGCGACCAGCGGATGGGACACATTACATATGA
AA sequence Show only first row Show all	>Lus10036654 pacid=23174441 polypeptide=Lus10036654 locus=Lus10036654.g ID=Lus10036654.BGIv1.0 annot-version=v1.0 MSIPAPRASGEALAGSWDGLRIVERAADADTRLDTLRSTMDGMMHAHVDWLPFGTPDFDGEARWSLYSGGIHGFDYIEPYGPNRVLRQYGYQQTIPNSIL TPELASRPADGTHYI

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G50750			Plant mobile domain protein fa...		Lus10036654 [exp]	0	1
AT1G31930		XLG3	extra-large GTP-binding protei...		Lus10024210 [exp]	6.3	0.6063
					Lus10014099 [exp]	8.9	0.6063
AT2G26975			Ctr copper transporter family ...		Lus10017205 [exp]	18.0	0.5806
AT2G32360			Ubiquitin-like superfamily pro...		Lus10027183 [exp]	19.6	0.5315
AT3G51070			S-adenosyl-L-methionine-depend...		Lus10025976 [exp]	21.9	0.5325
AT2G44840	AP2_ERF	ATERF13, EREBP	ethylene-responsive element bi...		Lus10029332 [exp]	23.6	0.5798
AT5G27740		RFC3, EMB251, E...	replication factor C 3, EMBRYO...		Lus10023810 [exp]	26.5	0.5638
AT3G60630	GRAS	ATHAM2, LOM2	LOST MERISTEMS 2, ARABIDOPSIS ...		Lus10012237 [exp]	33.5	0.4869
AT3G04720		HEL, PR-4, PR4	HEVEIN-LIKE, pathogenesis-rela...		Lus10020250 [exp]	36.5	0.5741
AT4G31970		CYP82C2, JAH1	"cytochrome P450, family 82, s...		Lus10028217 [exp]	37.5	0.5288

Compare expression of checked genes

Lus10036654 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.