Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G48380 124 / 4e-34 BIR1 BAK1-interacting receptor-like kinase 1 (.1) AT3G28450 97 / 2e-24 Leucine-rich repeat protein kinase family protein (.1) AT1G27190 89 / 9e-22 Leucine-rich repeat protein kinase family protein (.1) AT1G69990 89 / 1e-21 Leucine-rich repeat protein kinase family protein (.1) AT3G49750 60 / 2e-11 AtRLP44 receptor like protein 44 (.1) AT5G65830 57 / 2e-10 ATRLP57 receptor like protein 57 (.1) AT1G28440 54 / 3e-09 HSL1 HAESA-like 1 (.1) AT4G33430 49 / 1e-07 SERK3, RKS10, ELG, BAK1, ATSERK3, ATBAK1 RECEPTOR KINASES LIKE SERK 10, ELONGATED, SOMATIC EMBRYOGENESIS RECEPTOR-LIKE KINASE 3, BRI1-associated receptor kinase (.1.2) AT1G72300 48 / 4e-07 Leucine-rich receptor-like protein kinase family protein (.1) AT3G56370 47 / 6e-07 Leucine-rich repeat protein kinase family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10037226 [exp] 187 / 1e-60 AT5G48380 221 / 6e-68 BAK1-interacting receptor-like kinase 1 (.1) Lus10036697 [exp] 184 / 2e-59 AT5G48380 215 / 8e-66 BAK1-interacting receptor-like kinase 1 (.1) Lus10002147 [exp] 172 / 1e-51 AT5G48380 755 / 0.0 BAK1-interacting receptor-like kinase 1 (.1) Lus10008743 [exp] 171 / 4e-51 AT5G48380 764 / 0.0 BAK1-interacting receptor-like kinase 1 (.1) Lus10034278 [exp] 122 / 7e-35 AT5G48380 189 / 5e-55 BAK1-interacting receptor-like kinase 1 (.1) Lus10030812 [exp] 69 / 1e-14 AT3G28450 252 / 6e-80 Leucine-rich repeat protein kinase family protein (.1) Lus10030811 [exp] 68 / 5e-14 AT1G27190 772 / 0.0 Leucine-rich repeat protein kinase family protein (.1) Lus10011561 [exp] 67 / 6e-14 AT3G49750 394 / 7e-140 receptor like protein 44 (.1) Lus10019277 [exp] 64 / 7e-13 AT3G49750 399 / 8e-142 receptor like protein 44 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.002G240000 [exp] 156 / 8e-46 AT5G48380 721 / 0.0 BAK1-interacting receptor-like kinase 1 (.1) Potri.008G078900 [exp] 155 / 2e-45 AT5G48380 734 / 0.0 BAK1-interacting receptor-like kinase 1 (.1) Potri.010G177900 [exp] 147 / 2e-42 AT5G48380 731 / 0.0 BAK1-interacting receptor-like kinase 1 (.1) Potri.017G003800 [exp] 145 / 8e-42 AT5G48380 455 / 1e-153 BAK1-interacting receptor-like kinase 1 (.1) Potri.010G178050 [exp] 132 / 7e-37 AT5G48380 710 / 0.0 BAK1-interacting receptor-like kinase 1 (.1) Potri.017G003550 [exp] 120 / 1e-35 AT5G48380 180 / 5e-54 BAK1-interacting receptor-like kinase 1 (.1) Potri.017G004216 [exp] 122 / 4e-33 AT5G48380 412 / 2e-136 BAK1-interacting receptor-like kinase 1 (.1) Potri.017G138600 [exp] 105 / 2e-27 AT1G27190 712 / 0.0 Leucine-rich repeat protein kinase family protein (.1) Potri.017G074400 [exp] 102 / 4e-26 AT3G28450 761 / 0.0 Leucine-rich repeat protein kinase family protein (.1) Potri.004G081700 [exp] 101 / 4e-26 AT1G27190 747 / 0.0 Leucine-rich repeat protein kinase family protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0022 [flax] [poplar] LRR PF00560 [flax] [poplar] LRR_1 Leucine Rich Repeat
Representative CDS sequence Show only first row Show all	>Lus10036704 pacid=23171058 polypeptide=Lus10036704 locus=Lus10036704.g ID=Lus10036704.BGIv1.0 annot-version=v1.0 ATGGAATGCTTGAGGGCCATAAAAGATTCCCTTGAAGACCCTTTCGGCTACCTCAATTCTACATGGAACTTCAACAACGATACCGAAGGCTTCATCTGCA AGTTCACCAGAGTCGATTGTTGGCATCCTGACGAGAACAAGGTGTTGAAGATTCGCCTCTCCAACATGGGTCCCAAATCCCAGTTCCCCGTTGGAATCAA GAACTGCTCCAACATCACAAGCCTGGATCTTTCGAGTAACGAGCTGTTCGGACCAATTTCTGAAAACATAACCCATATTGTAGGTTTTGTAACATATCTG GATCTGTCTTCCAATAGGTTTTCGGGGCCAATTCCAGCCTGTGTACGCACATTTTATGCAGGCAGTTGTCCAAACACAATACATTTATAA
AA sequence Show only first row Show all	>Lus10036704 pacid=23171058 polypeptide=Lus10036704 locus=Lus10036704.g ID=Lus10036704.BGIv1.0 annot-version=v1.0 MECLRAIKDSLEDPFGYLNSTWNFNNDTEGFICKFTRVDCWHPDENKVLKIRLSNMGPKSQFPVGIKNCSNITSLDLSSNELFGPISENITHIVGFVTYL DLSSNRFSGPIPACVRTFYAGSCPNTIHL

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G48380		BIR1	BAK1-interacting receptor-like...		Lus10036704 [exp]	0	1
AT1G03440			Leucine-rich repeat (LRR) fami...		Lus10031601 [exp]	1.4	0.9683
AT5G10530			Concanavalin A-like lectin pro...		Lus10007077 [exp]	2.0	0.9432
AT5G62360			Plant invertase/pectin methyle...		Lus10024596 [exp]	3.5	0.9098
					Lus10012088 [exp]	4.6	0.8684
AT1G01420		UGT72B3	UDP-glucosyl transferase 72B3 ...		Lus10001905 [exp]	5.7	0.8886
					Lus10007146 [exp]	6.3	0.8538
AT1G71760			unknown protein		Lus10004010 [exp]	6.5	0.8801
AT2G20800		NDB4	NAD(P)H dehydrogenase B4 (.1)		Lus10018540 [exp]	9.2	0.8140
AT1G17930			Aminotransferase-like, plant m...		Lus10011644 [exp]	10.0	0.8802
AT1G72200			RING/U-box superfamily protein...		Lus10029794 [exp]	11.1	0.7564

Compare expression of checked genes

Lus10036704 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.