Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G03360 76 / 7e-18 Glycosyltransferase family 61 protein (.1.2) AT2G03370 72 / 2e-16 Glycosyltransferase family 61 protein (.1) AT3G57380 57 / 3e-11 Glycosyltransferase family 61 protein (.1) AT2G41640 56 / 9e-11 Glycosyltransferase family 61 protein (.1.2) AT3G10320 55 / 2e-10 Glycosyltransferase family 61 protein (.1) AT3G18180 54 / 4e-10 Glycosyltransferase family 61 protein (.1) AT3G18170 52 / 2e-09 Glycosyltransferase family 61 protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10036806 [exp] 142 / 4e-42 AT2G03370 381 / 4e-129 Glycosyltransferase family 61 protein (.1) Lus10035441 [exp] 53 / 1e-09 AT2G41640 560 / 0.0 Glycosyltransferase family 61 protein (.1.2) Lus10031057 [exp] 51 / 5e-09 AT2G41640 543 / 0.0 Glycosyltransferase family 61 protein (.1.2) Lus10031058 [exp] 50 / 1e-08 AT3G10310 880 / 0.0 P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain (.1) Lus10016707 [exp] 50 / 1e-08 AT3G18180 367 / 3e-122 Glycosyltransferase family 61 protein (.1) Lus10036003 [exp] 50 / 2e-08 AT3G18180 360 / 2e-119 Glycosyltransferase family 61 protein (.1) Lus10018046 [exp] 49 / 2e-08 AT3G10320 530 / 0.0 Glycosyltransferase family 61 protein (.1) Lus10042044 [exp] 49 / 2e-08 AT2G41640 257 / 4e-78 Glycosyltransferase family 61 protein (.1.2) Lus10018048 [exp] 46 / 4e-07 AT2G41640 569 / 0.0 Glycosyltransferase family 61 protein (.1.2)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.010G162200 [exp] 88 / 4e-22 AT2G03360 407 / 3e-139 Glycosyltransferase family 61 protein (.1.2) Potri.010G162100 [exp] 78 / 1e-18 AT2G03360 371 / 1e-124 Glycosyltransferase family 61 protein (.1.2) Potri.008G092700 [exp] 74 / 3e-17 AT2G03360 377 / 1e-127 Glycosyltransferase family 61 protein (.1.2) Potri.016G057000 [exp] 49 / 3e-08 AT2G41640 584 / 0.0 Glycosyltransferase family 61 protein (.1.2) Potri.012G051500 [exp] 47 / 2e-07 AT3G18170 451 / 1e-155 Glycosyltransferase family 61 protein (.1) Potri.015G042200 [exp] 47 / 2e-07 AT3G18180 441 / 3e-151 Glycosyltransferase family 61 protein (.1) Potri.006G048500 [exp] 46 / 3e-07 AT2G41640 604 / 0.0 Glycosyltransferase family 61 protein (.1.2) Potri.015G042300 [exp] 45 / 7e-07 AT3G18170 438 / 1e-150 Glycosyltransferase family 61 protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10037124 pacid=23152343 polypeptide=Lus10037124 locus=Lus10037124.g ID=Lus10037124.BGIv1.0 annot-version=v1.0 ATGGGGCTGCAGTACGAGTACAGGATTGCGGGGAATGAGAGCAGTCTAGCGGAGAAGTACGGACTCGAGAGCTTGGCAGTGAAGGATCCGACAGCTTTCG GAGGTAAAGGTTGGGGGAAGATGAAGATGTATTTGAGGAAGCAAGATGTGAGGATTGATTTGGTTCAGTTTAGGGTTTATTTGGAGGAAGCTTATCAAAA GGCCTTGAAGTTCATAAACACAAAAGAGTAG
AA sequence Show only first row Show all	>Lus10037124 pacid=23152343 polypeptide=Lus10037124 locus=Lus10037124.g ID=Lus10037124.BGIv1.0 annot-version=v1.0 MGLQYEYRIAGNESSLAEKYGLESLAVKDPTAFGGKGWGKMKMYLRKQDVRIDLVQFRVYLEEAYQKALKFINTKE

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G03360			Glycosyltransferase family 61 ...		Lus10037124 [exp]	0	1
AT5G53550		ATYSL3, YSL3	YELLOW STRIPE like 3 (.1.2)		Lus10008843 [exp]	3.9	0.7528
AT2G13620		ATCHX15	CATION/H+ EXCHANGER 15, cation...		Lus10013794 [exp]	4.5	0.7440
AT1G61105			Toll-Interleukin-Resistance (T...		Lus10011216 [exp]	4.7	0.7867
AT5G06060			NAD(P)-binding Rossmann-fold s...		Lus10010873 [exp]	7.9	0.7532
AT2G23755			unknown protein		Lus10000575 [exp]	10.5	0.6765
					Lus10002332 [exp]	17.7	0.6710
AT1G02335		GL22	germin-like protein subfamily ...		Lus10004856 [exp]	19.1	0.6710
AT3G05950			RmlC-like cupins superfamily p...		Lus10023351 [exp]	20.4	0.6710
AT2G31750		UGT74D1	UDP-glucosyl transferase 74D1 ...		Lus10009409 [exp]	21.6	0.6710
AT2G39040			Peroxidase superfamily protein...		Lus10021957 [exp]	22.6	0.6593

Compare expression of checked genes

Lus10037124 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.