Lus10037168 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10036759 93 / 2e-26 ND 33 / 0.007
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.015G062300 37 / 0.0002 AT3G47510 53 / 1e-10 unknown protein
Potri.008G087700 36 / 0.0004 ND /
PFAM info
Representative CDS sequence
>Lus10037168 pacid=23152414 polypeptide=Lus10037168 locus=Lus10037168.g ID=Lus10037168.BGIv1.0 annot-version=v1.0
ATGGCGGCAGCAAGCATCCTTGTTCATCATCATCGTTATATCCTATTGATTTTCCTCTCCATTCATCTTATCCTCTCATGGAATGCTTCTTCAGCTACTG
CACTAGGAACAGAGCAATTTCACGGACATCCTTTATCTTCCCCAGAGACCCAGAAGGTTGGGAGAAGGTTTGGGCATGGCAGAGTGGAAGTGGAAATGGA
GGGTTATGCTGGCTCAGGAGCTAACGACCGCCACACGCCGCCGAAGCCCACCGCCGGCGGAGCTTAA
AA sequence
>Lus10037168 pacid=23152414 polypeptide=Lus10037168 locus=Lus10037168.g ID=Lus10037168.BGIv1.0 annot-version=v1.0
MAAASILVHHHRYILLIFLSIHLILSWNASSATALGTEQFHGHPLSSPETQKVGRRFGHGRVEVEMEGYAGSGANDRHTPPKPTAGGA

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
Lus10037168 0 1
AT5G17230 PSY PHYTOENE SYNTHASE (.1.2.3) Lus10001050 6.0 0.8638
AT1G49570 Peroxidase superfamily protein... Lus10009901 7.0 0.8956
AT5G45890 SAG12 senescence-associated gene 12 ... Lus10004781 7.3 0.8680
AT3G53200 MYB ATMYB27 myb domain protein 27 (.1) Lus10023918 11.2 0.8852
AT1G49570 Peroxidase superfamily protein... Lus10023858 11.6 0.8349
AT1G69490 NAC NAP, ANAC029, A... Arabidopsis NAC domain contain... Lus10026617 23.2 0.8066
AT3G25400 unknown protein Lus10020407 27.3 0.8424
AT4G17260 Lactate/malate dehydrogenase f... Lus10002983 32.2 0.7619
AT3G10400 U11/U12-31K U11/U12-31K, RNA recognition m... Lus10037960 35.5 0.8028
AT3G04070 NAC ANAC047 NAC domain containing protein ... Lus10021992 38.5 0.8032

Lus10037168 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.