Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G10380 124 / 7e-36 Putative membrane lipoprotein (.1) AT5G50290 49 / 1e-07 unknown protein AT3G17350 38 / 0.0006 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10036687 [exp] 201 / 3e-66 AT1G10380 316 / 2e-108 Putative membrane lipoprotein (.1) Lus10037235 [exp] 188 / 4e-61 AT1G10380 318 / 5e-109 Putative membrane lipoprotein (.1) Lus10037078 [exp] 74 / 1e-16 AT1G10380 170 / 6e-50 Putative membrane lipoprotein (.1) Lus10042105 [exp] 54 / 1e-09 AT5G50290 366 / 9e-128 unknown protein Lus10001236 [exp] 54 / 1e-09 AT5G50290 368 / 2e-128 unknown protein Lus10036906 [exp] 42 / 2e-05 AT1G10380 129 / 4e-36 Putative membrane lipoprotein (.1) Lus10043098 [exp] 40 / 9e-05 AT3G17350 334 / 7e-115 unknown protein
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.010G040500 [exp] 137 / 3e-41 AT1G10380 337 / 2e-116 Putative membrane lipoprotein (.1) Potri.007G094800 [exp] 77 / 8e-18 AT1G10380 125 / 1e-33 Putative membrane lipoprotein (.1) Potri.010G158500 [exp] 71 / 1e-15 AT1G10380 164 / 1e-48 Putative membrane lipoprotein (.1) Potri.008G095900 [exp] 70 / 3e-15 AT1G10380 158 / 2e-46 Putative membrane lipoprotein (.1) Potri.015G078700 [exp] 43 / 7e-06 AT5G50290 387 / 4e-136 unknown protein Potri.008G099800 [exp] 40 / 0.0001 AT3G17350 332 / 2e-114 unknown protein Potri.010G152900 [exp] 40 / 0.0001 AT3G17350 339 / 4e-117 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10037237 pacid=23152349 polypeptide=Lus10037237 locus=Lus10037237.g ID=Lus10037237.BGIv1.0 annot-version=v1.0 ATGGACTTGGATAAGCTGAAGTGTTCGTCGTATGCTGGATTCTACAGTTTCAACGAGCAGGAGTCGAACCCGGATGAGTGGAAGTATGGGATTGCATTGA AGTATAAGTTCAATGTGTTTGATGATTACCCTGGTGCTTGTGCTAACTGTGAGAGAAGCCATGGTGTTTGTGGATACAGTTCTGGAGATTTTGATTCCTT TGTCTGCAACTGTCCTAGTGGATTCAATACAACTTCTGATTGTATCTTCTTTAGCCATGCTGCTTCAAGCCATCTCCCTTGCACCATTGGTAACTTTCTT CTTCTTATTATTCTTCTGCTTGTTGTACTGTAA
AA sequence Show only first row Show all	>Lus10037237 pacid=23152349 polypeptide=Lus10037237 locus=Lus10037237.g ID=Lus10037237.BGIv1.0 annot-version=v1.0 MDLDKLKCSSYAGFYSFNEQESNPDEWKYGIALKYKFNVFDDYPGACANCERSHGVCGYSSGDFDSFVCNCPSGFNTTSDCIFFSHAASSHLPCTIGNFL LLIILLLVVL

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G10380			Putative membrane lipoprotein ...		Lus10037237 [exp]	0	1
AT5G06800	GARP		myb-like HTH transcriptional r...		Lus10023816 [exp]	2.8	0.9126
AT5G18600			Thioredoxin superfamily protei...		Lus10033965 [exp]	5.0	0.9027
AT1G23550		SRO2	similar to RCD one 2 (.1)		Lus10013012 [exp]	5.1	0.9079
AT4G15690			Thioredoxin superfamily protei...		Lus10002887 [exp]	6.0	0.9048
AT2G17700		STY8	serine/threonine/tyrosine kina...		Lus10004153 [exp]	9.6	0.9064
AT1G02170		AtMCP1b, ATMC1,...	LSD ONE LIKE 3, ARABIDOPSIS TH...		Lus10015843 [exp]	12.2	0.8933
AT2G45010			PLAC8 family protein (.1.2)		Lus10028184 [exp]	12.7	0.8694
AT2G15680		AtCML30	calmodulin-like 30, Calcium-bi...		Lus10019863 [exp]	15.1	0.8671
AT1G24620			EF hand calcium-binding protei...		Lus10007816 [exp]	17.2	0.8902
AT5G19060			unknown protein		Lus10026459 [exp]	17.8	0.8125

Compare expression of checked genes

Lus10037237 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.