Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10036275 [exp] 106 / 2e-31 ND / Lus10021739 [exp] 79 / 4e-20 ND / Lus10009076 [exp] 61 / 3e-13 ND / Lus10042500 [exp] 42 / 6e-06 ND / Lus10027005 [exp] 41 / 6e-06 ND 36 / 9e-04 Lus10004431 [exp] 41 / 2e-05 ND / Lus10032865 [exp] 39 / 9e-05 AT2G01050 40 / 9e-05 zinc ion binding;nucleic acid binding (.1) Lus10019358 [exp] 37 / 0.0009 ND /
Poplar homologues Show only best Show top 10	No hit found
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10037474 pacid=23167266 polypeptide=Lus10037474 locus=Lus10037474.g ID=Lus10037474.BGIv1.0 annot-version=v1.0 ATGGCTACAAAGAAGAGTCTACCAAACACTTGGCAACCGATCTGTGGGGTGGAGATTACACAACTGGAAGACCATCATTTTCTATTCTGGTTTGCACATG AAGTTGACGTTCGAAACGTAATCAACAACGACCCTTGGTTTTTCGACAAACAGCTGCTGATTACTCATGAACTCCAACTGGGAGACAATCCGGCTAGGTG CCTTTATAACAAAACATCGATACCTCCGAACCTCGATCCGGGAGGCACGTCACAATTCCAGAAGACCACTCCGGGACAAGGACCTTCAATCTAA
AA sequence Show only first row Show all	>Lus10037474 pacid=23167266 polypeptide=Lus10037474 locus=Lus10037474.g ID=Lus10037474.BGIv1.0 annot-version=v1.0 MATKKSLPNTWQPICGVEITQLEDHHFLFWFAHEVDVRNVINNDPWFFDKQLLITHELQLGDNPARCLYNKTSIPPNLDPGGTSQFQKTTPGQGPSI

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10037474 [exp]	0	1
AT5G14380		AGP6	arabinogalactan protein 6 (.1)		Lus10022309 [exp]	2.2	0.7079
AT1G14190			Glucose-methanol-choline (GMC)...		Lus10026606 [exp]	9.9	0.6844
AT5G60440	MADS	AGL62	AGAMOUS-like 62 (.1)		Lus10035456 [exp]	22.6	0.6581
AT3G27810	MYB	AtMYB3, ATMYB21	ARABIDOPSIS THALIANA MYB DOMA...		Lus10022259 [exp]	27.8	0.6318
AT3G50845			Protein of unknown function (D...		Lus10014311 [exp]	29.9	0.6334
AT4G23350			Protein of Unknown Function (D...		Lus10042273 [exp]	31.4	0.6241
					Lus10008145 [exp]	33.0	0.4810
AT3G23730		XTH16	xyloglucan endotransglucosylas...		Lus10000678 [exp]	33.5	0.6117
					Lus10013963 [exp]	36.5	0.6183
AT1G06620			2-oxoglutarate (2OG) and Fe(II...		Lus10017701 [exp]	41.0	0.6178

Compare expression of checked genes

Lus10037474 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.