Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10005495 [exp] 196 / 4e-65 AT1G17930 54 / 2e-08 Aminotransferase-like, plant mobile domain family protein (.1) Lus10021566 [exp] 188 / 2e-61 AT1G17930 54 / 4e-08 Aminotransferase-like, plant mobile domain family protein (.1) Lus10039393 [exp] 186 / 2e-60 AT1G17930 73 / 3e-14 Aminotransferase-like, plant mobile domain family protein (.1) Lus10004830 [exp] 175 / 3e-56 AT1G17930 48 / 4e-06 Aminotransferase-like, plant mobile domain family protein (.1) Lus10022091 [exp] 176 / 2e-52 AT3G23070 860 / 0.0 CRM family member 3A (.1) Lus10005482 [exp] 162 / 2e-52 AT1G17930 41 / 1e-04 Aminotransferase-like, plant mobile domain family protein (.1) Lus10005957 [exp] 167 / 3e-52 AT1G48120 75 / 1e-14 hydrolases;protein serine/threonine phosphatases (.1) Lus10033313 [exp] 167 / 3e-52 AT1G17930 72 / 1e-13 Aminotransferase-like, plant mobile domain family protein (.1) Lus10023763 [exp] 151 / 2e-48 ND /
Poplar homologues Show only best Show top 10	No hit found
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF10536 [flax] [poplar] PMD Plant mobile domain
Representative CDS sequence Show only first row Show all	>Lus10037814 pacid=23167066 polypeptide=Lus10037814 locus=Lus10037814.g ID=Lus10037814.BGIv1.0 annot-version=v1.0 ATGGCGGGGAGTGTGTCTCTACTTCAGTCCTGGATTCACGAGTACTTCCCTAGTACTCGTGCTGCTAGAGTAGTGGCTCGGGAGCGGGGTGATACCGAGA CATTGGTTGGGCGGTGGAGCAGTATCGAGCAGCCAGATAGATCATACGACTTCATGCACCGTCGTCTGCAGTACTACCGTCATCTGCTAGATGAGATGAC CACACGGGATGTTATCTGGCTGCCATATGAGCCACGCCCCGAGGTGGAGGTTTCCGATTCGACGTTCCGTGGGGTCATTCGTTTCGGTCCGATAACAGAG TATTATGATCCGACGCGTGTGGTTACACAGTTCGGCTACGTGTAG
AA sequence Show only first row Show all	>Lus10037814 pacid=23167066 polypeptide=Lus10037814 locus=Lus10037814.g ID=Lus10037814.BGIv1.0 annot-version=v1.0 MAGSVSLLQSWIHEYFPSTRAARVVARERGDTETLVGRWSSIEQPDRSYDFMHRRLQYYRHLLDEMTTRDVIWLPYEPRPEVEVSDSTFRGVIRFGPITE YYDPTRVVTQFGYV

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10037814 [exp]	0	1
					Lus10000325 [exp]	3.0	1.0000
AT2G46760			D-arabinono-1,4-lactone oxidas...		Lus10004735 [exp]	5.2	1.0000
					Lus10002099 [exp]	5.8	1.0000
AT1G17930			Aminotransferase-like, plant m...		Lus10005495 [exp]	8.2	1.0000
					Lus10025316 [exp]	8.5	1.0000
AT2G40780			Nucleic acid-binding, OB-fold-...		Lus10030510 [exp]	9.2	1.0000
					Lus10011594 [exp]	9.2	1.0000
AT5G39200			unknown protein		Lus10030710 [exp]	9.8	1.0000
					Lus10032121 [exp]	9.9	1.0000
AT4G20800			FAD-binding Berberine family p...		Lus10006507 [exp]	10.8	1.0000

Compare expression of checked genes

Lus10037814 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.