Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10032744 [exp] 65 / 1e-14 ND / Lus10009076 [exp] 50 / 5e-09 ND / Lus10042500 [exp] 45 / 6e-07 ND / Lus10032865 [exp] 43 / 3e-06 AT2G01050 40 / 9e-05 zinc ion binding;nucleic acid binding (.1) Lus10002313 [exp] 40 / 7e-05 ND / Lus10004431 [exp] 38 / 0.0004 ND /
Poplar homologues Show only best Show top 10	No hit found
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10037828 pacid=23167282 polypeptide=Lus10037828 locus=Lus10037828.g ID=Lus10037828.BGIv1.0 annot-version=v1.0 ATGGAACAACATGTCTGTTGTCTGACTCTCGACGACAGTGATTACCAAGGAGTCTCCCTCATGGACATCATATCGGCTCTGCCACACCAAGAGTGCTCTC TCTGCCTGGCCAACACTTTCCTGGGCGACGAAGCCATCAACTTCACTGCGATGAAGCGCTCGATAGCGTTTATGAGGAAACCGGGATGGAAAATGAAAAT TGAGGGCCTCAATGATGGTCACTATCTGTTCAAGTTTCACCATGAGGTTGATCTGTGGCGTATCATGGGGGACGGGCCATTTGATTCTCCACGAGCTACA AGTGGATGA
AA sequence Show only first row Show all	>Lus10037828 pacid=23167282 polypeptide=Lus10037828 locus=Lus10037828.g ID=Lus10037828.BGIv1.0 annot-version=v1.0 MEQHVCCLTLDDSDYQGVSLMDIISALPHQECSLCLANTFLGDEAINFTAMKRSIAFMRKPGWKMKIEGLNDGHYLFKFHHEVDLWRIMGDGPFDSPRAT SG

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10037828 [exp]	0	1
					Lus10007204 [exp]	14.1	0.8614
					Lus10034708 [exp]	19.6	0.8494
AT3G02360			6-phosphogluconate dehydrogena...		Lus10029098 [exp]	27.1	0.7284
AT1G67325			Ran BP2/NZF zinc finger-like s...		Lus10015776 [exp]	29.3	0.8014
AT5G22730			F-box/RNI-like/FBD-like domain...		Lus10035308 [exp]	31.5	0.7642
ATMG00510		ATMG00510.1, NA...	NADH dehydrogenase subunit 7 (...		Lus10015033 [exp]	32.6	0.8329
AT1G65780			P-loop containing nucleoside t...		Lus10013768 [exp]	41.4	0.8130
ATMG01360		ATMG01360.1, CO...	cytochrome oxidase (.1)		Lus10009204 [exp]	41.4	0.8288
ATMG01360		ATMG01360.1, CO...	cytochrome oxidase (.1)		Lus10004084 [exp]	44.0	0.8286
					Lus10027106 [exp]	49.0	0.6968

Compare expression of checked genes

Lus10037828 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.