Lus10038154 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10042506 121 / 7e-36 AT4G16295 112 / 5e-32 S-protein homologue 1 (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.002G252500 44 / 5e-06 AT4G16295 116 / 9e-34 S-protein homologue 1 (.1)
PFAM info
Representative CDS sequence
>Lus10038154 pacid=23158321 polypeptide=Lus10038154 locus=Lus10038154.g ID=Lus10038154.BGIv1.0 annot-version=v1.0
ATGACCACCGAACAGGTCTGTATCCGGGACTATACTTCTCAGCGCCTTCTTGGCTTCTTCCAAACCACACACATATTACTCAATGCTTCAAGAGATCTTT
GCTTAAGGGTCAGCATTGCTTCACGGAAGGGTGTAACGGAGCTCGTCGACGTTACCGATTTTATCCAAACCCCGGATATAAACACCGTCGTCTTTCGCAA
TCCAAATGCACTTGCTCCACCCGCACTTGTAGAGCAACAACACGTCATGCCAGAACACTTTGAACGCCGCTTCCCCCCGCGACGTCGTTTGATCACGTGC
GTAGCACCAGAAGAGCGTCCTTCCAAACAAGTTCTCTCGGAAACCCCACGTGGAGTTCAACCCAACCGACAGATTCTTCAACCCCAGATCGTCGTCCTTG
GATTGGCAGTGTAG
AA sequence
>Lus10038154 pacid=23158321 polypeptide=Lus10038154 locus=Lus10038154.g ID=Lus10038154.BGIv1.0 annot-version=v1.0
MTTEQVCIRDYTSQRLLGFFQTTHILLNASRDLCLRVSIASRKGVTELVDVTDFIQTPDINTVVFRNPNALAPPALVEQQHVMPEHFERRFPPRRRLITC
VAPEERPSKQVLSETPRGVQPNRQILQPQIVVLGLAV

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
Lus10038154 0 1
AT4G29035 Plant self-incompatibility pro... Lus10022825 1.0 0.9806
AT1G73110 P-loop containing nucleoside t... Lus10024092 1.4 0.9763
AT2G30900 TBL43 TRICHOME BIREFRINGENCE-LIKE 43... Lus10007367 1.7 0.9576
AT4G18770 MYB ATMYB98 myb domain protein 98 (.1) Lus10042111 4.0 0.9461
AT2G45650 MADS AGL6 AGAMOUS-like 6 (.1) Lus10015017 7.1 0.9368
AT3G05610 Plant invertase/pectin methyle... Lus10020909 8.7 0.9054
Lus10017869 9.2 0.9312
AT1G69120 MADS AGL7, AP1 APETALA1, AGAMOUS-like 7, K-bo... Lus10017871 10.0 0.9018
AT2G04570 GDSL-like Lipase/Acylhydrolase... Lus10015162 10.2 0.9245
Lus10016041 10.4 0.9175

Lus10038154 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.