Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G34585 56 / 4e-12 unknown protein AT3G52420 43 / 5e-07 ATOEP7 outer envelope membrane protein 7 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10023307 [exp] 81 / 9e-22 AT2G34585 76 / 5e-20 unknown protein Lus10038559 [exp] 68 / 2e-15 AT2G34585 67 / 1e-14 unknown protein Lus10003733 [exp] 42 / 1e-06 AT3G52420 68 / 5e-17 outer envelope membrane protein 7 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.011G084300 [exp] 73 / 6e-19 AT2G34585 77 / 9e-21 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10038503 pacid=23158176 polypeptide=Lus10038503 locus=Lus10038503.g ID=Lus10038503.BGIv1.0 annot-version=v1.0 ATGGGAGCGGTGACGACGGCGATAATAGCGATAGCCGGAGTGATTCTGGGTTGGATCACCATCGAGATCGCTTGCAAGCCTTGCCTCGATCACGGCCGCC AAGCCATCGACCGATCTCTTAACCCTGACTACGATCCCGATGACGACGCCATTCGTGCCCCTTTGAACCCTCCTTCAAATTCAAATCCTCCCATTCTCGA ATCGCTTTCTTCCTCCACGGCGGCAAAGGCGATCTGA
AA sequence Show only first row Show all	>Lus10038503 pacid=23158176 polypeptide=Lus10038503 locus=Lus10038503.g ID=Lus10038503.BGIv1.0 annot-version=v1.0 MGAVTTAIIAIAGVILGWITIEIACKPCLDHGRQAIDRSLNPDYDPDDDAIRAPLNPPSNSNPPILESLSSSTAAKAI

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G34585			unknown protein		Lus10038503 [exp]	0	1
					Lus10004134 [exp]	1.4	0.8157
AT3G25130			unknown protein		Lus10022768 [exp]	1.7	0.8610
AT5G13440			Ubiquinol-cytochrome C reducta...		Lus10028416 [exp]	4.9	0.7666
AT3G25130			unknown protein		Lus10011835 [exp]	6.9	0.8016
AT3G51370			Protein phosphatase 2C family ...		Lus10028408 [exp]	9.5	0.7917
AT1G26355		SP1L1	SPIRAL1-like1 (.1)		Lus10004642 [exp]	17.5	0.7691
AT4G39950		CYP79B2	"cytochrome P450, family 79, s...		Lus10023143 [exp]	21.1	0.7387
AT5G14670		ATARFA1B	ADP-ribosylation factor A1B (....		Lus10030884 [exp]	22.4	0.8108
AT1G69080			Adenine nucleotide alpha hydro...		Lus10036814 [exp]	26.1	0.7396
AT2G34620			Mitochondrial transcription te...		Lus10014567 [exp]	26.3	0.7814

Compare expression of checked genes

Lus10038503 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.