Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G30260 59 / 3e-13 AGL79 unknown protein AT4G21060 49 / 2e-08 Galactosyltransferase family protein (.1.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10023289 [exp] 103 / 7e-31 AT1G30260 61 / 6e-14 unknown protein
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.011G081001 [exp] 71 / 9e-18 AT1G30260 68 / 2e-16 unknown protein Potri.004G133180 [exp] 66 / 8e-16 AT1G30260 61 / 1e-13 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10038517 pacid=23158287 polypeptide=Lus10038517 locus=Lus10038517.g ID=Lus10038517.BGIv1.0 annot-version=v1.0 ATGGCGAATGCACGCATAGCAAAGTTCGTGACAGAGGTGGCGCCTCCGCAGTACATTAAGGTGATGAGGAACAGAGCTACCAAGATGCTCGATACCATCA AGGAAGACGATCGATCTGATCATACTGTCGCCGCACAAACTAGTACTAGCAGTGGTACTAGTACTGCCGTTTCGAAATCGAAGTCGTCGTCGGGTTACTT CCTAGCTGGGATGCGCCAGCAATCACTTTTTGATCTCTGA
AA sequence Show only first row Show all	>Lus10038517 pacid=23158287 polypeptide=Lus10038517 locus=Lus10038517.g ID=Lus10038517.BGIv1.0 annot-version=v1.0 MANARIAKFVTEVAPPQYIKVMRNRATKMLDTIKEDDRSDHTVAAQTSTSSGTSTAVSKSKSSSGYFLAGMRQQSLFDL

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G30260		AGL79	unknown protein		Lus10038517 [exp]	0	1
AT1G30260		AGL79	unknown protein		Lus10023289 [exp]	1.7	0.8810
AT5G59310		LTP4	lipid transfer protein 4 (.1)		Lus10015278 [exp]	2.8	0.8909
AT2G45350		CRR4	CHLORORESPIRATORY REDUCTION 4,...		Lus10015874 [exp]	5.2	0.8966
AT4G17090		CT-BMY, BMY8, B...	BETA-AMYLASE 8, BETA-AMYLASE 3...		Lus10011035 [exp]	14.1	0.8449
AT3G50685			unknown protein		Lus10014321 [exp]	16.7	0.8218
AT4G17090		CT-BMY, BMY8, B...	BETA-AMYLASE 8, BETA-AMYLASE 3...		Lus10003005 [exp]	17.7	0.8376
AT3G54050		HCEF1	high cyclic electron flow 1 (....		Lus10035545 [exp]	20.1	0.8772
AT3G54050		HCEF1	high cyclic electron flow 1 (....		Lus10027748 [exp]	21.7	0.8765
AT3G15850		JB67, FADB, ADS...	FATTY ACID DESATURASE B, fatty...		Lus10011488 [exp]	28.9	0.8424
AT2G01590		CRR3	chlororespiratory reduction 3 ...		Lus10027792 [exp]	29.1	0.8397

Compare expression of checked genes

Lus10038517 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.