Lus10038953 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT1G18530 86 / 5e-22 EF hand calcium-binding protein family (.1)
AT3G25600 77 / 9e-19 Calcium-binding EF-hand family protein (.1)
AT1G32250 45 / 2e-06 Calcium-binding EF-hand family protein (.1)
AT4G14640 45 / 2e-06 CAM8, AtCML8 calmodulin-like 8, calmodulin 8 (.1)
AT3G22930 44 / 6e-06 CML11 calmodulin-like 11 (.1)
AT3G03000 42 / 2e-05 EF hand calcium-binding protein family (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10027243 127 / 3e-38 AT1G18530 208 / 5e-70 EF hand calcium-binding protein family (.1)
Lus10017900 90 / 2e-23 AT3G25600 252 / 4e-87 Calcium-binding EF-hand family protein (.1)
Lus10039961 59 / 2e-12 AT1G18530 67 / 1e-15 EF hand calcium-binding protein family (.1)
Lus10039391 44 / 4e-06 AT4G14640 268 / 1e-93 calmodulin-like 8, calmodulin 8 (.1)
Lus10030986 44 / 6e-06 AT1G32250 219 / 3e-74 Calcium-binding EF-hand family protein (.1)
Lus10035383 43 / 1e-05 AT1G32250 152 / 8e-48 Calcium-binding EF-hand family protein (.1)
Lus10004610 42 / 5e-05 AT3G03000 243 / 3e-83 EF hand calcium-binding protein family (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.015G052600 89 / 3e-23 AT1G18530 213 / 8e-72 EF hand calcium-binding protein family (.1)
Potri.010G132800 89 / 3e-23 AT3G25600 229 / 4e-78 Calcium-binding EF-hand family protein (.1)
Potri.003G095700 54 / 2e-09 AT3G03000 220 / 1e-74 EF hand calcium-binding protein family (.1)
Potri.001G138000 52 / 5e-09 AT3G03000 221 / 8e-75 EF hand calcium-binding protein family (.1)
Potri.010G080900 42 / 1e-05 AT4G14640 270 / 2e-94 calmodulin-like 8, calmodulin 8 (.1)
Potri.008G159300 42 / 3e-05 AT3G22930 235 / 1e-80 calmodulin-like 11 (.1)
Potri.005G215700 39 / 0.0003 AT3G22930 200 / 8e-67 calmodulin-like 11 (.1)
PFAM info
Representative CDS sequence
>Lus10038953 pacid=23150358 polypeptide=Lus10038953 locus=Lus10038953.g ID=Lus10038953.BGIv1.0 annot-version=v1.0
ATGGGCGCCGTGACGATGACGACGCTACGGATGAGCCAGCTCCGCGACATATTTGATAGGTTTGACATGGACTCGGACGGGAGTCTGACAGTGTTAGAGC
TGGCGGCGTTGCTCCGGTCGCTAGGGTTGTCGGCCTCCGGCGATGAGATCCACGACCTCCTGACGAACATGGACTCAAACGGGAACGGACTCGTCGAATT
CGAGGAGCTGGTGGACGCGATCTCCAACCAGATCGACGAGCAGACGCTAGTGAACCAGGAGCAGCTGCTGGAGATCTTCCAGCTGTTCGACCGGGGACGG
GAACGGTGTGATAACGAAGGTGGAGCTCGCCGGCGGCTTGGCGAAGATGGGGCAGCCGCTGACGTGGAGGGAGCTAACGGAGATGATGATACAAGCGGAT
ACCAACGGCGACGGCGTGATTAG
AA sequence
>Lus10038953 pacid=23150358 polypeptide=Lus10038953 locus=Lus10038953.g ID=Lus10038953.BGIv1.0 annot-version=v1.0
MGAVTMTTLRMSQLRDIFDRFDMDSDGSLTVLELAALLRSLGLSASGDEIHDLLTNMDSNGNGLVEFEELVDAISNQIDEQTLVNQEQLLEIFQLFDRGR
ERCDNEGGARRRLGEDGAAADVEGANGDDDTSGYQRRRRD

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT1G18530 EF hand calcium-binding protei... Lus10038953 0 1
Lus10022179 2.4 0.6827
AT4G12080 AT-hook ATAHL1, AHL1 AT-hook motif nuclear-localize... Lus10000381 4.1 0.7239
AT5G61000 ATRPA70D Replication factor-A protein 1... Lus10003025 12.7 0.7031
AT2G44760 Domain of unknown function (DU... Lus10020744 16.4 0.6281
AT3G25180 CYP82G1 cytochrome P450, family 82, su... Lus10016287 16.9 0.6601
AT3G25440 LOH1 LAG One Homologue 1, RNA-bindi... Lus10009566 21.9 0.5809
AT3G59650 mitochondrial ribosomal protei... Lus10022178 27.0 0.6464
AT4G12490 Bifunctional inhibitor/lipid-t... Lus10024623 31.0 0.5747
AT1G76810 eukaryotic translation initiat... Lus10023474 32.2 0.6288
AT4G12080 AT-hook ATAHL1, AHL1 AT-hook motif nuclear-localize... Lus10000177 34.6 0.5422

Lus10038953 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.