Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G24130 103 / 7e-28 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10001061 [exp] 135 / 2e-40 AT5G24130 326 / 2e-111 unknown protein
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.015G021300 [exp] 103 / 6e-29 AT5G24130 205 / 6e-66 unknown protein Potri.015G021100 [exp] 105 / 8e-29 AT5G24130 310 / 1e-105 unknown protein Potri.015G021400 [exp] 102 / 7e-28 AT5G24130 308 / 6e-105 unknown protein Potri.012G031000 [exp] 101 / 2e-27 AT5G24130 306 / 4e-104 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10039332 pacid=23175501 polypeptide=Lus10039332 locus=Lus10039332.g ID=Lus10039332.BGIv1.0 annot-version=v1.0 ATGGGGAAGCTGGCGTCGGCGAGGGAGCACAGGATGTACGGCCCGAGGCTGAGCCGGAACCGAGCCGAGTACGTCAACGCCGGGCTATACCTTTTCGCCA CGATCGTGCTCGTCTCCGGGTTCGCGGCCCAGTTCTCGAGGGAGCCCAGGTCGGGTCTCGTGCTGTTGTTGATCGCTTTGCTGATCGTGGTGGCGGTTAG TGTTCACGACATGGTGGCCCACCTGGCCGGTGTCGATTACCGCCTCCCGCGTCTTATTCCCGAGTCTTATGGTGTACGACCCACAGTTGGCGCTTGTTGA
AA sequence Show only first row Show all	>Lus10039332 pacid=23175501 polypeptide=Lus10039332 locus=Lus10039332.g ID=Lus10039332.BGIv1.0 annot-version=v1.0 MGKLASAREHRMYGPRLSRNRAEYVNAGLYLFATIVLVSGFAAQFSREPRSGLVLLLIALLIVVAVSVHDMVAHLAGVDYRLPRLIPESYGVRPTVGAC

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G24130			unknown protein		Lus10039332 [exp]	0	1
AT5G24130			unknown protein		Lus10039333 [exp]	1.0	0.9097
AT5G55050			GDSL-like Lipase/Acylhydrolase...		Lus10021540 [exp]	2.8	0.8999
AT1G33720		CYP76C6	"cytochrome P450, family 76, s...		Lus10006323 [exp]	6.7	0.8257
AT5G48540			receptor-like protein kinase-r...		Lus10038227 [exp]	7.5	0.8740
AT1G28480		roxy19, GRX480	Thioredoxin superfamily protei...		Lus10017693 [exp]	7.9	0.8596
					Lus10028146 [exp]	7.9	0.8047
AT5G48490			Bifunctional inhibitor/lipid-t...		Lus10016323 [exp]	9.5	0.8478
AT4G27290			S-locus lectin protein kinase ...		Lus10014813 [exp]	9.6	0.8682
AT2G15820		OTP51	ORGANELLE TRANSCRIPT PROCESSIN...		Lus10023856 [exp]	9.8	0.8567
AT2G19130			S-locus lectin protein kinase ...		Lus10029802 [exp]	11.0	0.8646

Compare expression of checked genes

Lus10039332 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.