Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10039765 [exp] 70 / 2e-17 ND / Lus10039763 [exp] 66 / 1e-15 ND / Lus10018538 [exp] 60 / 5e-13 AT2G35635 51 / 6e-09 RELATED TO UBIQUITIN 2, ubiquitin 7 (.1) Lus10033891 [exp] 49 / 4e-09 ND / Lus10003555 [exp] 47 / 3e-08 ND / Lus10024888 [exp] 46 / 4e-07 AT2G36070 445 / 8e-154 translocase inner membrane subunit 44-2 (.1) Lus10033892 [exp] 38 / 7e-05 ND /
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.007G117900 [exp] 50 / 1e-09 ND / Potri.005G061780 [exp] 50 / 3e-09 ND / Potri.007G106900 [exp] 50 / 3e-09 ND / Potri.005G224300 [exp] 47 / 2e-08 ND / Potri.007G109600 [exp] 47 / 2e-08 ND / Potri.002G038350 [exp] 45 / 2e-07 ND /
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0187 [flax] [poplar] LysM PF01476 [flax] [poplar] LysM LysM domain
Representative CDS sequence Show only first row Show all	>Lus10039764 pacid=23165054 polypeptide=Lus10039764 locus=Lus10039764.g ID=Lus10039764.BGIv1.0 annot-version=v1.0 ATGGCTAGCTTCTCCATGAAGATGATCAACTCCATCTCGATCACCTCCATCATCATCATCCTGATCGTCATGATCTCCACAGCTGAAAGCACCAGCCCAG ACGAGTGTACGGTGACTTGTTCGACGTTGGTCGCGGTGCCGGCCGGCGGGAGCTGTTACTCTGTTTCTGAAGCGCACGGCATTACCATGGACAAGTTCAA ATCTCTGAACCCGAATCTGGTCTGCAGCAGGATTTTCGCCGAGGAGTGGGTTTGCGTCGCTGGACTTGCCTGTTGA
AA sequence Show only first row Show all	>Lus10039764 pacid=23165054 polypeptide=Lus10039764 locus=Lus10039764.g ID=Lus10039764.BGIv1.0 annot-version=v1.0 MASFSMKMINSISITSIIIILIVMISTAESTSPDECTVTCSTLVAVPAGGSCYSVSEAHGITMDKFKSLNPNLVCSRIFAEEWVCVAGLAC

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10039764 [exp]	0	1
AT2G40410			Staphylococcal nuclease homolo...		Lus10041146 [exp]	1.4	0.8652
					Lus10013650 [exp]	1.7	0.9036
					Lus10013649 [exp]	3.0	0.8603
AT1G14040			EXS (ERD1/XPR1/SYG1) family pr...		Lus10000203 [exp]	4.7	0.8168
AT3G55960			Haloacid dehalogenase-like hyd...		Lus10040202 [exp]	6.3	0.8226
AT1G75790		SKS18	SKU5 similar 18 (.1)		Lus10038672 [exp]	6.9	0.8156
AT1G19250		FMO1	flavin-dependent monooxygenase...		Lus10005178 [exp]	7.3	0.8256
AT2G25660		EMB2410	embryo defective 2410 (.1)		Lus10012414 [exp]	7.5	0.8084
					Lus10002344 [exp]	8.1	0.8344
					Lus10022938 [exp]	9.4	0.8266

Compare expression of checked genes

Lus10039764 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.