Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10039764 [exp] 72 / 5e-18 ND / Lus10039763 [exp] 69 / 9e-17 ND / Lus10018538 [exp] 65 / 2e-15 AT2G35635 51 / 6e-09 RELATED TO UBIQUITIN 2, ubiquitin 7 (.1) Lus10033891 [exp] 49 / 3e-09 ND / Lus10003555 [exp] 47 / 2e-08 ND / Lus10024888 [exp] 46 / 4e-07 AT2G36070 445 / 8e-154 translocase inner membrane subunit 44-2 (.1) Lus10033892 [exp] 36 / 0.0003 ND /
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.005G224300 [exp] 51 / 6e-10 ND / Potri.007G106900 [exp] 49 / 6e-09 ND / Potri.007G117900 [exp] 48 / 7e-09 ND / Potri.007G109600 [exp] 45 / 2e-07 ND / Potri.002G038350 [exp] 44 / 3e-07 ND / Potri.005G061780 [exp] 40 / 8e-06 ND /
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0187 [flax] [poplar] LysM PF01476 [flax] [poplar] LysM LysM domain
Representative CDS sequence Show only first row Show all	>Lus10039765 pacid=23165032 polypeptide=Lus10039765 locus=Lus10039765.g ID=Lus10039765.BGIv1.0 annot-version=v1.0 ATGGTGCTGATCATGATATCCACAGCCGAAAGCACCGGCAGGCATCTTCTGACCCCAGGCTGTAAAGTAACTTGTACCAACTGGGTCGCAGTGGAAATGG ACGAAACCTGTACTACAATTTCTGAAGCCAACCGCATGACAGTAAACAAGTTCCTAACTCTCAACCCGAATCTTGTTTGTGAGAAAATGTTCGCTGACGA ATGGGTCTGCATCGAAGGCACTGGCTGTTGA
AA sequence Show only first row Show all	>Lus10039765 pacid=23165032 polypeptide=Lus10039765 locus=Lus10039765.g ID=Lus10039765.BGIv1.0 annot-version=v1.0 MVLIMISTAESTGRHLLTPGCKVTCTNWVAVEMDETCTTISEANRMTVNKFLTLNPNLVCEKMFADEWVCIEGTGC

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10039765 [exp]	0	1
AT5G44120		ATCRA1, CRU1, C...	CRUCIFERINA, RmlC-like cupins ...		Lus10010341 [exp]	2.8	0.9129
					Lus10010697 [exp]	4.9	0.8944
					Lus10008327 [exp]	6.0	0.8944
AT2G27110	FAR1_related	FRS3	FAR1-related sequence 3 (.1.2....		Lus10008762 [exp]	6.9	0.8944
AT4G13230			Late embryogenesis abundant pr...		Lus10022822 [exp]	7.7	0.8944
AT5G20610			unknown protein		Lus10025003 [exp]	8.5	0.8944
					Lus10024618 [exp]	9.2	0.8829
AT5G12480		CPK7	calmodulin-domain protein kina...		Lus10026300 [exp]	9.8	0.8736
AT3G04720		HEL, PR-4, PR4	HEVEIN-LIKE, pathogenesis-rela...		Lus10020252 [exp]	11.0	0.8359
AT4G12560		CPR1, CPR30	CONSTITUTIVE EXPRESSER OF PR G...		Lus10000190 [exp]	11.2	0.8466

Compare expression of checked genes

Lus10039765 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.