Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G03560 130 / 5e-37 Pentatricopeptide repeat (PPR-like) superfamily protein (.1) AT5G65560 39 / 8e-05 Pentatricopeptide repeat (PPR) superfamily protein (.1) AT5G18390 38 / 0.0002 Pentatricopeptide repeat (PPR) superfamily protein (.1) AT5G61990 37 / 0.0006 Pentatricopeptide repeat (PPR) superfamily protein (.1) AT4G19440 37 / 0.0007 Tetratricopeptide repeat (TPR)-like superfamily protein (.1), Tetratricopeptide repeat (TPR)-like superfamily protein (.2) AT3G22470 37 / 0.0007 Pentatricopeptide repeat (PPR) superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10018567 [exp] 152 / 9e-45 AT1G03560 862 / 0.0 Pentatricopeptide repeat (PPR-like) superfamily protein (.1) Lus10042016 [exp] 41 / 2e-05 AT2G32630 600 / 0.0 Pentatricopeptide repeat (PPR-like) superfamily protein (.1) Lus10018019 [exp] 39 / 9e-05 AT2G32630 590 / 0.0 Pentatricopeptide repeat (PPR-like) superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.019G103400 [exp] 144 / 5e-42 AT1G03560 911 / 0.0 Pentatricopeptide repeat (PPR-like) superfamily protein (.1) Potri.013G130600 [exp] 44 / 1e-06 AT1G12700 330 / 3e-105 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1) Potri.005G050180 [exp] 41 / 1e-05 AT1G12700 488 / 2e-164 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1) Potri.005G050300 [exp] 41 / 1e-05 AT1G12700 466 / 5e-156 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1) Potri.006G124900 [exp] 40 / 4e-05 AT5G65560 909 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1) Potri.005G038400 [exp] 39 / 8e-05 AT1G12700 478 / 7e-161 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1) Potri.005G050400 [exp] 39 / 8e-05 AT1G12700 504 / 3e-171 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1) Potri.005G050240 [exp] 38 / 0.0002 AT1G12700 465 / 1e-155 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1) Potri.005G046200 [exp] 38 / 0.0002 AT1G12700 501 / 5e-170 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0020 [flax] [poplar] TPR PF01535 [flax] [poplar] PPR PPR repeat
Representative CDS sequence Show only first row Show all	>Lus10039798 pacid=23165395 polypeptide=Lus10039798 locus=Lus10039798.g ID=Lus10039798.BGIv1.0 annot-version=v1.0 ATGCTTAATGTATTGTGTAAAGCAGGAAGGGTGAAGGAGGCTTGCAAGTTGGCTGATGGGATCGTAGATAGGGGTCGAGAAGTTCCTGGGAGAGTCCGTA CTGCTTTGTTGAATGCGTTGTGGAAAGCTGGCAATGCGGATATGGCCTTGAAATTGATGCATAGCAAGGTTGGTATTGGGTACGATAGAATGGGTAGTGT TAAAAGGAGAGTGAAGTTTCGAATCCTTCTCGAAGGTTAA
AA sequence Show only first row Show all	>Lus10039798 pacid=23165395 polypeptide=Lus10039798 locus=Lus10039798.g ID=Lus10039798.BGIv1.0 annot-version=v1.0 MLNVLCKAGRVKEACKLADGIVDRGREVPGRVRTALLNALWKAGNADMALKLMHSKVGIGYDRMGSVKRRVKFRILLEG

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G03560			Pentatricopeptide repeat (PPR-...		Lus10039798 [exp]	0	1
AT1G09220			Pentatricopeptide repeat (PPR)...		Lus10011341 [exp]	6.5	0.8803
AT5G14100		ABCI11, ATNAP14	ARABIDOPSIS THALIANANON-INTRIN...		Lus10032025 [exp]	25.3	0.8094
AT2G39000			Acyl-CoA N-acyltransferases (N...		Lus10040401 [exp]	31.7	0.8220
AT4G15880		ATESD4, ESD4	EARLY IN SHORT DAYS 4, Cystein...		Lus10023104 [exp]	42.0	0.7939
AT5G13240			transcription regulators (.1)		Lus10007961 [exp]	50.3	0.8078
AT2G23180		CYP96A1	"cytochrome P450, family 96, s...		Lus10003669 [exp]	55.9	0.7948
AT3G51940			unknown protein		Lus10039572 [exp]	75.8	0.7890
AT3G25570			Adenosylmethionine decarboxyla...		Lus10019146 [exp]	93.7	0.7723
AT2G45330		TRPT, EMB1067	2' tRNA phosphotransferase, em...		Lus10009289 [exp]	104.3	0.7626
AT5G19960			RNA-binding (RRM/RBD/RNP motif...		Lus10017757 [exp]	112.7	0.7715

Compare expression of checked genes

Lus10039798 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.