Lus10039895 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT5G60860 397 / 5e-143 AtRABA1f RAB GTPase homolog A1F (.1)
AT3G15060 380 / 2e-136 AtRABA1g RAB GTPase homolog A1G (.1)
AT1G28550 366 / 1e-130 AtRABA1i RAB GTPase homolog A1I (.1)
AT4G18430 360 / 3e-128 AtRABA1e RAB GTPase homolog A1E (.1)
AT2G33870 359 / 5e-128 ArRABA1h RAB GTPase homolog A1H (.1)
AT4G18800 337 / 4e-119 AthSGBP, AtRab11B, AtRABA1d RAB GTPase homolog A1D (.1)
AT5G45750 330 / 1e-116 AtRABA1c RAB GTPase homolog A1C (.1)
AT1G16920 315 / 1e-110 ATRABA4B, RAB11, ATRABA1B RAB GTPase homolog A1B (.1)
AT1G06400 313 / 1e-109 ARA2, AtRABA1a, AtRab11E, Ara-2 ARABIDOPSIS THALIANA RAB GTPASE HOMOLOG A1A, Ras-related small GTP-binding family protein (.1)
AT1G09630 281 / 4e-97 ATRAB-A2A, ATRAB11C, ATRABA2A ARABIDOPSIS RAB GTPASE A2A, RAB GTPase 11C (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10017679 412 / 7e-149 AT5G60860 426 / 4e-154 RAB GTPase homolog A1F (.1)
Lus10002178 412 / 9e-149 AT5G60860 423 / 4e-153 RAB GTPase homolog A1F (.1)
Lus10015297 396 / 2e-142 AT5G60860 428 / 6e-155 RAB GTPase homolog A1F (.1)
Lus10025432 390 / 3e-140 AT5G60860 422 / 1e-152 RAB GTPase homolog A1F (.1)
Lus10013961 381 / 1e-136 AT5G60860 412 / 7e-149 RAB GTPase homolog A1F (.1)
Lus10029253 332 / 6e-117 AT5G45750 393 / 4e-141 RAB GTPase homolog A1C (.1)
Lus10007306 328 / 9e-116 AT5G45750 387 / 5e-139 RAB GTPase homolog A1C (.1)
Lus10020746 305 / 1e-106 AT1G06400 375 / 3e-134 ARABIDOPSIS THALIANA RAB GTPASE HOMOLOG A1A, Ras-related small GTP-binding family protein (.1)
Lus10029789 305 / 2e-106 AT1G06400 373 / 3e-133 ARABIDOPSIS THALIANA RAB GTPASE HOMOLOG A1A, Ras-related small GTP-binding family protein (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.013G123600 402 / 4e-145 AT5G60860 419 / 2e-151 RAB GTPase homolog A1F (.1)
Potri.019G092500 401 / 1e-144 AT5G60860 419 / 2e-151 RAB GTPase homolog A1F (.1)
Potri.001G374000 385 / 3e-138 AT5G60860 417 / 1e-150 RAB GTPase homolog A1F (.1)
Potri.011G061300 384 / 1e-137 AT5G60860 416 / 5e-150 RAB GTPase homolog A1F (.1)
Potri.011G070300 333 / 2e-117 AT5G45750 392 / 1e-140 RAB GTPase homolog A1C (.1)
Potri.004G061000 331 / 1e-116 AT4G18800 392 / 9e-141 RAB GTPase homolog A1D (.1)
Potri.003G004100 281 / 5e-97 AT1G09630 382 / 6e-137 ARABIDOPSIS RAB GTPASE A2A, RAB GTPase 11C (.1)
Potri.006G000300 274 / 2e-94 AT1G07410 400 / 4e-144 ARABIDOPSIS RAB GTPASE HOMOLOG A2B, RAB GTPase homolog A2B (.1)
Potri.008G061300 271 / 4e-93 AT1G07410 367 / 9e-131 ARABIDOPSIS RAB GTPASE HOMOLOG A2B, RAB GTPase homolog A2B (.1)
Potri.010G197200 268 / 4e-92 AT1G07410 370 / 3e-132 ARABIDOPSIS RAB GTPASE HOMOLOG A2B, RAB GTPase homolog A2B (.1)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
CL0023 P-loop_NTPase PF00071 Ras Ras family
Representative CDS sequence
>Lus10039895 pacid=23165179 polypeptide=Lus10039895 locus=Lus10039895.g ID=Lus10039895.BGIv1.0 annot-version=v1.0
ATGGGAGCTTACAGGGCCGACGACGACTACGACTACTTGTTCAAGGTCGTCTTGATAGGCGACTCCGGCGTCGGGAAATCCAATCTCCTGTCCAGATTCA
CCAGGAACGAGTTCAGCCTCGAGTCCAAATCCACAATCGGCGTTGAATTCGCCACCCGCAGCATCCACGTCGATGACAAGGTCGTCAAAGCCCAGATTTG
GGACACTGCTGGACAAGAAAGAGGTGCAGTCGGTGCTTTGCTCGTCTACGATGTCACTCGGCACGTCACATTTGAAAACGTGGAGAGGTGGTTAAAAGAG
CTCCGCGACCACACTGATGCCAACATTGTGATCATGCTTGTCGGAAACAAGGCCGATCTTCGACACCTCCGTGCTGTTCAGACTGAGGACTCCAAGGCAT
TTGCAGAGAGGGAGAACACTTTCTTCATGGAAACTTCCGCCCTCGAATCCTTGAATGTCGAGAACGCCTTTACTGAGGTGCTCACCCAGATATACCGGGT
CGTCAGCCGGAAAGCCCTCGATGTCGGAGACGACCCTGCAGCCTTGCCCAAAGGACAGACTATTAACGTCGGCAAGGATGATGTATCAGCTGTTAAGAAA
GTCGGGTGCTGCTCTGCATAG
AA sequence
>Lus10039895 pacid=23165179 polypeptide=Lus10039895 locus=Lus10039895.g ID=Lus10039895.BGIv1.0 annot-version=v1.0
MGAYRADDDYDYLFKVVLIGDSGVGKSNLLSRFTRNEFSLESKSTIGVEFATRSIHVDDKVVKAQIWDTAGQERGAVGALLVYDVTRHVTFENVERWLKE
LRDHTDANIVIMLVGNKADLRHLRAVQTEDSKAFAERENTFFMETSALESLNVENAFTEVLTQIYRVVSRKALDVGDDPAALPKGQTINVGKDDVSAVKK
VGCCSA

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT5G60860 AtRABA1f RAB GTPase homolog A1F (.1) Lus10039895 0 1
AT3G62110 Pectin lyase-like superfamily ... Lus10038030 2.4 0.9035
AT3G24350 ATSYP32, SYP32 syntaxin of plants 32 (.1.2) Lus10033080 3.6 0.8590
AT5G25510 Protein phosphatase 2A regulat... Lus10033069 4.0 0.8560
AT3G27320 alpha/beta-Hydrolases superfam... Lus10022326 4.0 0.8825
AT1G78530 Protein kinase superfamily pro... Lus10005569 5.7 0.8628
AT2G16595 Translocon-associated protein ... Lus10026282 6.3 0.8644
AT5G58300 Leucine-rich repeat protein ki... Lus10019113 6.6 0.8448
AT4G17890 UBP20, AGD8 ARF-GAP domain 8 (.1.2) Lus10000903 6.7 0.8696
AT5G16730 Plant protein of unknown funct... Lus10009550 8.1 0.8816
AT1G74690 IQD31 IQ-domain 31 (.1) Lus10042173 8.5 0.8755

Lus10039895 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.