Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G42620 84 / 7e-20 PPS, PP2, ORE9, MAX2 PLEIOTROPIC PHOTOSIGNALING, ORESARA 9, MORE AXILLARY BRANCHES 2, RNI-like superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10002715 [exp] 199 / 1e-67 AT2G42620 85 / 2e-20 PLEIOTROPIC PHOTOSIGNALING, ORESARA 9, MORE AXILLARY BRANCHES 2, RNI-like superfamily protein (.1) Lus10020707 [exp] 133 / 2e-37 AT2G42620 845 / 0.0 PLEIOTROPIC PHOTOSIGNALING, ORESARA 9, MORE AXILLARY BRANCHES 2, RNI-like superfamily protein (.1) Lus10029834 [exp] 132 / 7e-37 AT2G42620 843 / 0.0 PLEIOTROPIC PHOTOSIGNALING, ORESARA 9, MORE AXILLARY BRANCHES 2, RNI-like superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.014G142600 [exp] 84 / 3e-20 AT2G42620 854 / 0.0 PLEIOTROPIC PHOTOSIGNALING, ORESARA 9, MORE AXILLARY BRANCHES 2, RNI-like superfamily protein (.1) Potri.011G066700 [exp] 71 / 2e-15 AT2G42620 717 / 0.0 PLEIOTROPIC PHOTOSIGNALING, ORESARA 9, MORE AXILLARY BRANCHES 2, RNI-like superfamily protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10040230 pacid=23174106 polypeptide=Lus10040230 locus=Lus10040230.g ID=Lus10040230.BGIv1.0 annot-version=v1.0 ATGACCACCGCAGAATCTCCGGCGAAAACAATCAACGATCTTCCCGATGTCACTCTCTTCGAGATATGCGCCGCCGTCTCCGACACTCGAGCTCGCAACT CCCTCGCCCTCTTGAACCACAAGTTCCACACCCTTGAGCGCTCCACGCTCTACTCCCTCACGATGCGGGGAAACGCGCGAGATCTCTTCCTCGTCCCGTC CTGCTTCCGATCGAAGAATGGAATGAAGAAGAAAACAGCAGCAGCTGCAACTAAGGATGAGGAAGATGATCATTCTGCAGTTGCTCTGAGTGTTAACGGA AGGAAGGAAGAGTTCACTAACGGCGTCAAGGGAGAAGTGGTCCGTTAA
AA sequence Show only first row Show all	>Lus10040230 pacid=23174106 polypeptide=Lus10040230 locus=Lus10040230.g ID=Lus10040230.BGIv1.0 annot-version=v1.0 MTTAESPAKTINDLPDVTLFEICAAVSDTRARNSLALLNHKFHTLERSTLYSLTMRGNARDLFLVPSCFRSKNGMKKKTAAAATKDEEDDHSAVALSVNG RKEEFTNGVKGEVVR

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G42620		PPS, PP2, ORE9,...	PLEIOTROPIC PHOTOSIGNALING, OR...		Lus10040230 [exp]	0	1
AT2G42620		PPS, PP2, ORE9,...	PLEIOTROPIC PHOTOSIGNALING, OR...		Lus10002715 [exp]	1.0	0.8480
AT1G13570			F-box/RNI-like superfamily pro...		Lus10020638 [exp]	2.4	0.8049
AT3G55960			Haloacid dehalogenase-like hyd...		Lus10040202 [exp]	2.4	0.8244
					Lus10027235 [exp]	2.8	0.7966
					Lus10008904 [exp]	6.3	0.7642
AT2G25660		EMB2410	embryo defective 2410 (.1)		Lus10012414 [exp]	13.5	0.7269
					Lus10013650 [exp]	13.9	0.7589
AT5G11100		SYT4, NTMCTYPE2...	synaptotagmin 4, Calcium-depen...		Lus10041034 [exp]	16.9	0.6747
					Lus10013649 [exp]	17.0	0.7154
AT2G40190		LEW3	LEAF WILTING 3, UDP-Glycosyltr...		Lus10010207 [exp]	17.7	0.5748

Compare expression of checked genes

Lus10040230 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.