Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G01140 39 / 0.0001 Protein of unknown function (DUF674) (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10008717 [exp] 81 / 3e-21 AT2G40070 52 / 5e-09 unknown protein Lus10003163 [exp] 74 / 2e-17 AT3G09110 100 / 2e-24 Protein of unknown function (DUF674) (.1) Lus10003167 [exp] 69 / 2e-15 AT3G09140 100 / 5e-25 Protein of unknown function (DUF674) (.1), Protein of unknown function (DUF674) (.2) Lus10003164 [exp] 65 / 4e-14 AT5G01130 95 / 6e-23 Protein of unknown function (DUF674) (.1) Lus10002340 [exp] 59 / 2e-12 AT5G01150 47 / 4e-07 Protein of unknown function (DUF674) (.1) Lus10003166 [exp] 60 / 3e-12 AT3G09110 104 / 3e-26 Protein of unknown function (DUF674) (.1) Lus10011225 [exp] 56 / 1e-10 AT5G01150 89 / 4e-20 Protein of unknown function (DUF674) (.1) Lus10003168 [exp] 54 / 4e-10 AT5G01150 94 / 2e-22 Protein of unknown function (DUF674) (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.010G210500 [exp] 67 / 7e-15 AT3G09110 73 / 4e-15 Protein of unknown function (DUF674) (.1) Potri.010G210400 [exp] 66 / 8e-15 ND / Potri.008G050100 [exp] 66 / 2e-14 ND / Potri.010G210800 [exp] 64 / 1e-13 AT3G09110 86 / 2e-19 Protein of unknown function (DUF674) (.1) Potri.010G210600 [exp] 55 / 1e-10 ND / Potri.008G050000 [exp] 47 / 1e-07 AT3G09110 94 / 1e-22 Protein of unknown function (DUF674) (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF05056 [flax] [poplar] DUF674 Protein of unknown function (DUF674)
Representative CDS sequence Show only first row Show all	>Lus10040317 pacid=23174028 polypeptide=Lus10040317 locus=Lus10040317.g ID=Lus10040317.BGIv1.0 annot-version=v1.0 ATGGTGATGGATGATCTGAGAGTGAATCAATTGTCGATGATCTCTGCTCTTACTTTGCTCAACAAACTCGGTTGCAAGGATCTTGGTGCCCTGGACGAGA TGGAGGTTGAGCTTGGAATCAATGAGGCAAGGAAGCTGTTGAAGGCATCTCTTGAATCGAAAGATGTTCTGACGAATGTATACCTTGTGAAGAAAGAGGA AGCCAAGGATGTTGCAGAAGAGGTAATCATAAGTCGTGGATGCTCTGATGGTGTCACTATCCAATCAATTTAG
AA sequence Show only first row Show all	>Lus10040317 pacid=23174028 polypeptide=Lus10040317 locus=Lus10040317.g ID=Lus10040317.BGIv1.0 annot-version=v1.0 MVMDDLRVNQLSMISALTLLNKLGCKDLGALDEMEVELGINEARKLLKASLESKDVLTNVYLVKKEEAKDVAEEVIISRGCSDGVTIQSI

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G01140			Protein of unknown function (D...		Lus10040317 [exp]	0	1
AT2G29880			unknown protein		Lus10005028 [exp]	3.2	0.7200
					Lus10040835 [exp]	4.2	0.7473
AT4G35420		TKPR1, DRL1	tetraketide alpha-pyrone reduc...		Lus10006141 [exp]	7.5	0.7143
AT5G45840			Leucine-rich repeat protein ki...		Lus10007281 [exp]	11.0	0.6951
					Lus10009381 [exp]	11.3	0.7040
					Lus10012495 [exp]	11.5	0.6693
AT3G10910			RING/U-box superfamily protein...		Lus10033425 [exp]	13.0	0.6486
					Lus10008679 [exp]	15.5	0.5866
AT4G29035			Plant self-incompatibility pro...		Lus10019767 [exp]	18.3	0.6126
AT1G02010		SEC1A	secretory 1A (.1.2)		Lus10009293 [exp]	19.9	0.6149

Compare expression of checked genes

Lus10040317 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.