Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G13520 73 / 2e-16 peptidase M1 family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.008G045900 [exp] 81 / 3e-19 AT5G13520 965 / 0.0 peptidase M1 family protein (.1) Potri.010G215700 [exp] 75 / 5e-17 AT5G13520 926 / 0.0 peptidase M1 family protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10040362 pacid=23174211 polypeptide=Lus10040362 locus=Lus10040362.g ID=Lus10040362.BGIv1.0 annot-version=v1.0 ATGGCGCCGATCGATCCACACTCGTATACCGACTCCGCTCACCCGCTAACAACCCACGTCTCCCTCACCTTCTACTTCGACTTCCCTTCCTCCACCATAC ACGCCGCCGCACTCCTCACCCTCTCCTCCCCACACTCCGGCGACCTCTCCCTCGCTCTCCCCCCGATTCCCCCGCTCTCCGTTGGCTCTCTCCACCGCAG ACGTTCAACAAGGCCCACCCCTTCGTCTACACGCAATGCCAGTCGATCCACGCTCGATCGGTCTTCCCCTGCCAGGACACTCCCGCAGCTCGTATCTGCT ACTCCGCGAAGCTGA
AA sequence Show only first row Show all	>Lus10040362 pacid=23174211 polypeptide=Lus10040362 locus=Lus10040362.g ID=Lus10040362.BGIv1.0 annot-version=v1.0 MAPIDPHSYTDSAHPLTTHVSLTFYFDFPSSTIHAAALLTLSSPHSGDLSLALPPIPPLSVGSLHRRRSTRPTPSSTRNASRSTLDRSSPARTLPQLVSA TPRS

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G13520			peptidase M1 family protein (....		Lus10040362 [exp]	0	1
AT5G13520			peptidase M1 family protein (....		Lus10040361 [exp]	1.0	0.8519
AT4G25240		SKS1	SKU5 similar 1 (.1)		Lus10031722 [exp]	7.3	0.8242
AT1G48480		RKL1	receptor-like kinase 1 (.1)		Lus10041991 [exp]	12.8	0.8216
AT1G79500		ATKDSA1, KDSA	Aldolase-type TIM barrel famil...		Lus10009595 [exp]	19.9	0.8202
AT5G12470			Protein of unknown function (D...		Lus10003180 [exp]	21.7	0.7848
AT4G18570			Tetratricopeptide repeat (TPR)...		Lus10025419 [exp]	34.2	0.7150
AT2G32940		AGO6	ARGONAUTE 6, Argonaute family ...		Lus10035331 [exp]	37.5	0.7989
AT5G33320		ARAPPT, CUE1	PHOSPHOENOLPYRUVATE/PHOSPHATE ...		Lus10002385 [exp]	40.4	0.7743
AT1G21880		LYM1	lysm domain GPI-anchored prote...		Lus10018191 [exp]	48.4	0.7889
AT4G25240		SKS1	SKU5 similar 1 (.1)		Lus10031143 [exp]	52.1	0.7791

Compare expression of checked genes

Lus10040362 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.