Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G62810 157 / 1e-51 complex 1 family protein / LVR family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10021599 [exp] 205 / 3e-70 AT3G62810 157 / 2e-51 complex 1 family protein / LVR family protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.014G129800 [exp] 159 / 3e-52 AT3G62810 158 / 9e-52 complex 1 family protein / LVR family protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10040570 pacid=23157758 polypeptide=Lus10040570 locus=Lus10040570.g ID=Lus10040570.BGIv1.0 annot-version=v1.0 ATGCTACGAGCAGAAGCCTTAACTGCATACAAAGCTCTGCTAAGAGCTACTCGTAAATCATTTGCTGGTGACCAGATGATGTTGAATGCTTCAAGCATTG AGATCCGGACGAAATTCGAAGAGAATCGTCTCGTGAACTCTGAGACTGAGATCAAAAGGCTCCTTGAAGAGGCACGTGAGGCATCTGATTTCATAGCAAC CATGATCGTTCAAGCCAAGTTGAATGAACGGGGTGGCTATGAGATAAAGGCGAGTAAGGAACATGCTGATGCAACACTTGAGATTCCATCAGAGGAGCTT CTTCGCAAGACCAGCTGA
AA sequence Show only first row Show all	>Lus10040570 pacid=23157758 polypeptide=Lus10040570 locus=Lus10040570.g ID=Lus10040570.BGIv1.0 annot-version=v1.0 MLRAEALTAYKALLRATRKSFAGDQMMLNASSIEIRTKFEENRLVNSETEIKRLLEEAREASDFIATMIVQAKLNERGGYEIKASKEHADATLEIPSEEL LRKTS

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G62810			complex 1 family protein / LVR...		Lus10040570 [exp]	0	1
AT1G29990		PFD6, PDF6	prefoldin 6 (.1)		Lus10038496 [exp]	6.2	0.8003
AT1G56450		PBG1	20S proteasome beta subunit G1...		Lus10011640 [exp]	6.3	0.7530
AT1G67785			unknown protein		Lus10018082 [exp]	16.6	0.6751
AT3G11500			Small nuclear ribonucleoprotei...		Lus10017019 [exp]	20.5	0.7839
AT2G01640			unknown protein		Lus10002816 [exp]	22.4	0.7723
AT2G21250			NAD(P)-linked oxidoreductase s...		Lus10018058 [exp]	24.7	0.7141
AT1G78790			unknown protein		Lus10042781 [exp]	28.6	0.6876
AT2G33370			Ribosomal protein L14p/L23e fa...		Lus10011773 [exp]	29.6	0.7819
AT3G62810			complex 1 family protein / LVR...		Lus10021599 [exp]	30.0	0.7121
AT4G29170		ATMND1	Mnd1 family protein (.1.2)		Lus10002503 [exp]	32.2	0.7175

Compare expression of checked genes

Lus10040570 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.