Lus10040621 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT4G09550 104 / 2e-31 ATGIP1 ARABIDOPSIS ATGCP3 INTERACTING PROTEIN 1, AtGCP3 interacting protein 1 (.1)
AT1G73790 97 / 9e-29 Protein of unknown function (DUF3743) (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10018288 130 / 1e-41 AT4G09550 103 / 3e-31 ARABIDOPSIS ATGCP3 INTERACTING PROTEIN 1, AtGCP3 interacting protein 1 (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.016G034200 100 / 9e-30 AT4G09550 102 / 1e-30 ARABIDOPSIS ATGCP3 INTERACTING PROTEIN 1, AtGCP3 interacting protein 1 (.1)
Potri.006G035900 100 / 9e-30 AT4G09550 100 / 5e-30 ARABIDOPSIS ATGCP3 INTERACTING PROTEIN 1, AtGCP3 interacting protein 1 (.1)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
PF12554 MOZART1 Mitotic-spindle organizing gamma-tubulin ring associated
Representative CDS sequence
>Lus10040621 pacid=23157637 polypeptide=Lus10040621 locus=Lus10040621.g ID=Lus10040621.BGIv1.0 annot-version=v1.0
ATGGATAAAGAAGCGGCAAGGACGGCAAGGGAATCGCTGGAGCTTGCGTTCCAGATGTCCAACGTTCTGGAAACGGGTCTCGATCGCCATACCCTCTCCG
TGTTGATCGGCCTCTGCGATCTCGGATTGAACCCGGAGGCACTCGCCGCTGTCGTCAAAGAACTCCGGTCCCAAGCCTTGCCTCATCATCCACCATCGTC
TTGA
AA sequence
>Lus10040621 pacid=23157637 polypeptide=Lus10040621 locus=Lus10040621.g ID=Lus10040621.BGIv1.0 annot-version=v1.0
MDKEAARTARESLELAFQMSNVLETGLDRHTLSVLIGLCDLGLNPEALAAVVKELRSQALPHHPPSS

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT4G09550 ATGIP1 ARABIDOPSIS ATGCP3 INTERACTING... Lus10040621 0 1
AT3G10400 U11/U12-31K U11/U12-31K, RNA recognition m... Lus10038693 1.4 0.8366
AT5G49060 Heat shock protein DnaJ, N-ter... Lus10006515 5.8 0.8039
AT1G21770 Acyl-CoA N-acyltransferases (N... Lus10018168 6.6 0.7902
AT4G13520 SMAP1 small acidic protein 1 (.1) Lus10023702 6.7 0.7858
AT2G37975 Yos1-like protein (.1) Lus10017192 7.9 0.7609
AT1G12260 NAC ANAC007, VND4, ... VASCULAR RELATED NAC-DOMAIN PR... Lus10019638 12.0 0.7813
AT1G29850 double-stranded DNA-binding fa... Lus10004540 12.4 0.7961
AT3G03750 SUVR3, SDG20 SET domain protein 20 (.1.2) Lus10003864 14.5 0.7432
AT2G33845 Nucleic acid-binding, OB-fold-... Lus10015411 15.2 0.7640
AT2G44020 Mitochondrial transcription te... Lus10004534 15.9 0.7586

Lus10040621 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.