Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G35640 59 / 1e-11 Trihelix Homeodomain-like superfamily protein (.1) AT1G31310 47 / 4e-07 Trihelix hydroxyproline-rich glycoprotein family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10018283 [exp] 40 / 2e-05 AT2G35640 93 / 6e-24 Homeodomain-like superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.012G117500 [exp] 60 / 9e-12 AT2G35640 184 / 2e-55 Homeodomain-like superfamily protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10040628 pacid=23157808 polypeptide=Lus10040628 locus=Lus10040628.g ID=Lus10040628.BGIv1.0 annot-version=v1.0 ATGGCCGATCCATCCATCAGTACCGGAGTCATGATCAGAGACTACCGCAAAGGCAACTGGACCATCACCGAGACCATGGTCCTCATCGAAGCCAAGAAAC TCAACGACGAGCGGCGGATGAACCGGATCACCGCCGGCGGCGGAGGGGGATGGAAACACATCAGCGGCCGGACAAGGAACGCAGCAGCACAAGTAAGGCA GGTGGGGAGCTGCGGTGGAAATGGGTGGAGGACTACTGCTGGAAGAAAGGCTGTTTCCGTAGTCAGAACCAGTGCAACGACAAGTGGGACAACTTAA
AA sequence Show only first row Show all	>Lus10040628 pacid=23157808 polypeptide=Lus10040628 locus=Lus10040628.g ID=Lus10040628.BGIv1.0 annot-version=v1.0 MADPSISTGVMIRDYRKGNWTITETMVLIEAKKLNDERRMNRITAGGGGGWKHISGRTRNAAAQVRQVGSCGGNGWRTTAGRKAVSVVRTSATTSGTT

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G35640	Trihelix		Homeodomain-like superfamily p...		Lus10040628 [exp]	0	1
AT2G02540	ZF_HD	ATHB21, ZFHD4, ...	ZINC FINGER HOMEODOMAIN 3, ZIN...		Lus10038135 [exp]	1.7	0.9875
AT1G68480	C2H2ZnF	JAG	JAGGED, C2H2 and C2HC zinc fin...		Lus10041443 [exp]	2.0	0.9862
AT3G13960	GRF	ATGRF5	growth-regulating factor 5 (.1...		Lus10000473 [exp]	2.2	0.9764
AT1G64080		MAKR2	MEMBRANE-ASSOCIATED KINASE REG...		Lus10017532 [exp]	3.2	0.9713
AT2G35640	Trihelix		Homeodomain-like superfamily p...		Lus10018283 [exp]	3.9	0.9810
AT1G11600		CYP77B1	"cytochrome P450, family 77, s...		Lus10007660 [exp]	4.0	0.9767
AT5G51560			Leucine-rich repeat protein ki...		Lus10031703 [exp]	6.0	0.9731
AT3G13960	GRF	ATGRF5	growth-regulating factor 5 (.1...		Lus10033441 [exp]	6.5	0.9764
AT1G27950		LTPG1	glycosylphosphatidylinositol-a...		Lus10037027 [exp]	6.9	0.9643
AT3G02645			Plant protein of unknown funct...		Lus10031159 [exp]	7.5	0.9734

Compare expression of checked genes

Lus10040628 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.