Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G22870 94 / 3e-25 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) AT1G08160 74 / 4e-17 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) AT2G35980 64 / 3e-13 NHL10, YLS9, ATNHL10 YELLOW-LEAF-SPECIFIC GENE 9, ARABIDOPSIS NDR1/HIN1-LIKE 10, Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) AT2G27080 53 / 3e-09 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1), Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.2) AT3G11650 52 / 3e-09 NHL2 NDR1/HIN1-like 2 (.1) AT5G53730 51 / 8e-09 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) AT5G21130 52 / 1e-08 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) AT2G35460 46 / 9e-07 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) AT2G35970 40 / 6e-05 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) AT3G11660 39 / 0.0001 NHL1 NDR1/HIN1-like 1 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10021404 [exp] 162 / 8e-52 AT5G22870 151 / 6e-46 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) Lus10016161 [exp] 162 / 8e-52 AT5G22870 148 / 8e-45 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) Lus10016962 [exp] 63 / 5e-13 AT2G35980 237 / 3e-79 YELLOW-LEAF-SPECIFIC GENE 9, ARABIDOPSIS NDR1/HIN1-LIKE 10, Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) Lus10021287 [exp] 62 / 9e-13 AT2G35980 236 / 7e-79 YELLOW-LEAF-SPECIFIC GENE 9, ARABIDOPSIS NDR1/HIN1-LIKE 10, Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) Lus10013329 [exp] 57 / 2e-11 AT2G27260 89 / 1e-22 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) Lus10021288 [exp] 58 / 5e-11 AT2G35980 237 / 2e-79 YELLOW-LEAF-SPECIFIC GENE 9, ARABIDOPSIS NDR1/HIN1-LIKE 10, Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) Lus10005216 [exp] 54 / 1e-09 AT2G27260 152 / 2e-45 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) Lus10031317 [exp] 44 / 6e-06 AT1G54540 231 / 1e-76 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) Lus10031888 [exp] 44 / 6e-06 AT1G54540 236 / 2e-78 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.009G003800 [exp] 137 / 5e-42 AT5G22870 179 / 4e-57 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) Potri.006G204300 [exp] 58 / 2e-11 AT2G35980 208 / 6e-68 YELLOW-LEAF-SPECIFIC GENE 9, ARABIDOPSIS NDR1/HIN1-LIKE 10, Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) Potri.012G006000 [exp] 58 / 4e-11 AT5G53730 225 / 4e-75 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) Potri.015G002400 [exp] 57 / 4e-11 AT5G53730 227 / 7e-76 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) Potri.016G071600 [exp] 57 / 7e-11 AT2G35980 205 / 9e-67 YELLOW-LEAF-SPECIFIC GENE 9, ARABIDOPSIS NDR1/HIN1-LIKE 10, Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) Potri.009G158900 [exp] 56 / 3e-10 AT2G27080 259 / 8e-87 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1), Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.2) Potri.009G019800 [exp] 51 / 2e-08 AT2G27260 96 / 1e-23 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) Potri.001G218300 [exp] 46 / 8e-07 AT2G27260 94 / 6e-23 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1) Potri.004G197600 [exp] 45 / 2e-06 AT2G27080 264 / 8e-89 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.1), Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family (.2) Potri.016G071500 [exp] 43 / 6e-06 AT3G11660 272 / 1e-93 NDR1/HIN1-like 1 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0159 [flax] [poplar] E-set PF03168 [flax] [poplar] LEA_2 Late embryogenesis abundant protein
Representative CDS sequence Show only first row Show all	>Lus10041350 pacid=23179542 polypeptide=Lus10041350 locus=Lus10041350.g ID=Lus10041350.BGIv1.0 annot-version=v1.0 ATGTCAGTGTACTACGACGTCATCGAGTTCTCCACCGCGTTCGACGGCCAGACGGTAGCCTTCAACACTCTGCCTCCGTTCCACCAGCCCAAGCGTAATG TCACGGTGCTTGAAGCCAGGCTGGAGTCCCGCGACGTGGCACTCTCCCATTCGCTGTCGAAAGACGTCCGGCACCAGCGGGCATCCGGTACGGCCAAGAT GCAGCTCCGTATCCGGGCAAGGATCCGGTTCAAAGTCGGGTCGATCCGTCTGAGACGCCAGACGCTCAAGATCCTCTGCACTGATGTCCCCGTCAGTTTC CACTCCGGCCAGAATAATCAGAAGACCGACTGTGACATGGACTACTAA
AA sequence Show only first row Show all	>Lus10041350 pacid=23179542 polypeptide=Lus10041350 locus=Lus10041350.g ID=Lus10041350.BGIv1.0 annot-version=v1.0 MSVYYDVIEFSTAFDGQTVAFNTLPPFHQPKRNVTVLEARLESRDVALSHSLSKDVRHQRASGTAKMQLRIRARIRFKVGSIRLRRQTLKILCTDVPVSF HSGQNNQKTDCDMDY

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G22870			Late embryogenesis abundant (L...		Lus10041350 [exp]	0	1
AT2G37925		COPT4	copper transporter 4 (.1)		Lus10021108 [exp]	1.0	0.9493
AT1G60360			RING/U-box superfamily protein...		Lus10028063 [exp]	3.7	0.9432
AT4G05220			Late embryogenesis abundant (L...		Lus10006755 [exp]	3.9	0.9335
AT5G48060			C2 calcium/lipid-binding plant...		Lus10037479 [exp]	7.5	0.9197
AT3G55370	DOF	OBP3, AtDof3. 6	OBF-binding protein 3 (.1.2.3)		Lus10016566 [exp]	8.8	0.9132
AT3G17730	NAC	ANAC057	NAC domain containing protein ...		Lus10042284 [exp]	9.0	0.9179
AT1G10380			Putative membrane lipoprotein ...		Lus10036687 [exp]	9.2	0.9249
AT4G16640			Matrixin family protein (.1)		Lus10004728 [exp]	9.4	0.9137
AT1G68430			unknown protein		Lus10034103 [exp]	9.9	0.9106
AT3G20570		AtENODL9	early nodulin-like protein 9 (...		Lus10011158 [exp]	11.0	0.9264

Compare expression of checked genes

Lus10041350 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.