Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G18245 101 / 2e-26 alpha/beta-Hydrolases superfamily protein (.1) AT3G19970 92 / 7e-23 alpha/beta-Hydrolases superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10028314 [exp] 210 / 2e-69 AT2G18245 216 / 1e-67 alpha/beta-Hydrolases superfamily protein (.1) Lus10026001 [exp] 146 / 2e-43 AT2G18245 283 / 2e-92 alpha/beta-Hydrolases superfamily protein (.1) Lus10014294 [exp] 137 / 4e-40 AT2G18245 195 / 2e-71 alpha/beta-Hydrolases superfamily protein (.1) Lus10017376 [exp] 97 / 2e-24 AT3G19970 534 / 0.0 alpha/beta-Hydrolases superfamily protein (.1) Lus10010171 [exp] 94 / 2e-23 AT3G19970 528 / 0.0 alpha/beta-Hydrolases superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.007G023000 [exp] 137 / 7e-40 AT2G18245 330 / 2e-110 alpha/beta-Hydrolases superfamily protein (.1) Potri.005G089000 [exp] 95 / 7e-24 AT3G19970 509 / 5e-180 alpha/beta-Hydrolases superfamily protein (.1) Potri.007G075400 [exp] 91 / 2e-22 AT3G19970 514 / 0.0 alpha/beta-Hydrolases superfamily protein (.1) Potri.009G103500 [exp] 39 / 0.0003 AT2G15695 528 / 0.0 Protein of unknown function DUF829, transmembrane 53 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0028 [flax] [poplar] AB_hydrolase PF05705 [flax] [poplar] DUF829 Eukaryotic protein of unknown function (DUF829)
Representative CDS sequence Show only first row Show all	>Lus10041762 pacid=23146946 polypeptide=Lus10041762 locus=Lus10041762.g ID=Lus10041762.BGIv1.0 annot-version=v1.0 ATGGGAAATCCTGCTCCTGAAACTGGCGGGTTTTTCGCCTGGCATCCAGCTCCTGAAACTGGCGGCGGGAGTGGTGTTTTCGGACGGAAATATGCTGAAA AGACTGTGGTTTTGCTGGGATGGCTGGATGGGAAGCAGAAGCACCTCAGGAGGTACGTGGAATGGTACAATTCACAAGGGATTCACGCGATTACGTTCGT CGTTGAAGTAGGAGAACTGCTAGGTTCTGATTCAGGGGAAAGAATGGACAGACGGATCACTGCATTGGCTAACGACATCACTTCTTGGGTCACCGAAGAC GGTGAATTGAACAGAGATCCATGTTTGCTGTTTCACACTTTCAGTAACACTGGCTTTGGGCGTAGGGTTTGA
AA sequence Show only first row Show all	>Lus10041762 pacid=23146946 polypeptide=Lus10041762 locus=Lus10041762.g ID=Lus10041762.BGIv1.0 annot-version=v1.0 MGNPAPETGGFFAWHPAPETGGGSGVFGRKYAEKTVVLLGWLDGKQKHLRRYVEWYNSQGIHAITFVVEVGELLGSDSGERMDRRITALANDITSWVTED GELNRDPCLLFHTFSNTGFGRRV

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G18245			alpha/beta-Hydrolases superfam...		Lus10041762 [exp]	0	1
AT5G43270	SBP	SPL2	squamosa promoter binding prot...		Lus10021614 [exp]	2.0	0.9172
AT3G24420			alpha/beta-Hydrolases superfam...		Lus10033087 [exp]	3.0	0.9295
AT5G48930		HCT	hydroxycinnamoyl-CoA shikimate...		Lus10026123 [exp]	7.7	0.8705
AT1G52240		PIRF1, ATROPGEF...	phytochrome interacting RopGEF...		Lus10021496 [exp]	7.7	0.9178
					Lus10024084 [exp]	8.0	0.9274
AT1G54730			Major facilitator superfamily ...		Lus10033815 [exp]	10.4	0.9158
AT5G12920			Transducin/WD40 repeat-like su...		Lus10031253 [exp]	10.6	0.9138
AT3G11720			Polyketide cyclase/dehydrase a...		Lus10016185 [exp]	10.6	0.8720
AT1G15260			unknown protein		Lus10011448 [exp]	12.0	0.9169
AT5G14950		GMII, ATGMII	golgi alpha-mannosidase II (.1...		Lus10032179 [exp]	17.3	0.8974

Compare expression of checked genes

Lus10041762 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.